Šajā tīmekļa vietnē tiek izmantotas sīkdatnes. Turpinot lietot šo vietni, jūs piekrītat sīkdatņu izmantošanai. Uzzināt vairāk.

Piekrītu
  • Atvērt paplašināto meklēšanu
  • Aizvērt paplašināto meklēšanu
Pievienot parametrus
Dokumenta numurs
Pievienot parametrus
publicēts
pieņemts
stājies spēkā
Pievienot parametrus
Aizvērt paplašināto meklēšanu
RĪKI

Ministru kabinets
Oficiālajā izdevumā publicē:
  • Ministru kabineta noteikumus, instrukcijas un ieteikumus. Tie stājas spēkā nākamajā dienā pēc izsludināšanas, ja tiesību aktā nav noteikts cits spēkā stāšanās termiņš;
  • Ministru kabineta rīkojumus. Tie stājas spēkā parakstīšanas brīdī;
  • Ministru kabineta sēdes protokollēmumus. Tie stājas spēkā pieņemšanas brīdī.

Ministru kabineta izdotos tiesību aktus publicēšanai nosūta Valsts kanceleja. Tie publicējami parasti divu darbdienu laikā pēc dokumenta saņemšanas.

TIESĪBU AKTI, KAS PAREDZ OFICIĀLO PUBLIKĀCIJU PERSONAS DATU APSTRĀDE

Publikācijas atsauce

ATSAUCĒ IETVERT:
Ministru kabineta 2017. gada 14. marta noteikumi Nr. 146 "Noteikumi par veterinārajām prasībām akvakultūras dzīvniekiem, no tiem iegūtiem produktiem un to apritei, kā arī atsevišķu akvakultūras dzīvnieku infekcijas slimību profilaksei un apkarošanai". Publicēts oficiālajā izdevumā "Latvijas Vēstnesis", 24.03.2017., Nr. 62 (5889) https://www.vestnesis.lv/op/2017/62.2

Paraksts pārbaudīts

NĀKAMAIS

Ministru kabineta noteikumi Nr. 147

Grozījumi Ministru kabineta 2015. gada 10. marta noteikumos Nr. 126 "Tiešo maksājumu piešķiršanas kārtība lauksaimniekiem"

Vēl šajā numurā

24.03.2017., Nr. 62 (5889)

PAR DOKUMENTU

Izdevējs: Ministru kabinets

Veids: noteikumi

Numurs: 146

Pieņemts: 14.03.2017.

OP numurs: 2017/62.2

2017/62.2
RĪKI

Ministru kabineta noteikumi: Šajā laidienā 5 Pēdējās nedēļas laikā 10 Visi

Ministru kabineta noteikumi Nr. 146

Rīgā 2017. gada 14. martā (prot. Nr. 12 24. §)

Noteikumi par veterinārajām prasībām akvakultūras dzīvniekiem, no tiem iegūtiem produktiem un to apritei, kā arī atsevišķu akvakultūras dzīvnieku infekcijas slimību profilaksei un apkarošanai

Izdoti saskaņā ar Veterinārmedicīnas likuma
25. panta 1. un 10. punktu

I. Vispārīgie jautājumi

1. Noteikumi nosaka veterinārās prasības akvakultūras dzīvniekiem, no tiem iegūtajiem produktiem un to apritei, kā arī atsevišķu akvakultūras dzīvnieku infekcijas slimību profilaksei un apkarošanai.

2. Noteikumos lietoti šādi termini:

2.1. akvakultūra – ūdensdzīvnieku audzēšana vai kultivēšana, izmantojot metodes, kas paaugstina šo dzīvnieku ražību virs vides dabiskā līmeņa, ja šie dzīvnieki vairošanās vai audzēšanas laikā līdz pat to savākšanai (ieskaitot) atrodas vienas vai vairāku fizisku vai juridisku personu īpašumā;

2.2. akvakultūras kontroldzīvnieki – akvakultūras dzīvnieki, ko izmanto akvakultūras dzīvnieku infekcijas slimību diagnosticēšanai karantīnas laikā;

2.3. akvakultūras nozares uzņēmums – organizatoriski saimnieciska vienība, kurā tiek veiktas ar akvakultūras dzīvnieku izaudzēšanu, audzēšanu vai turēšanu saistītas darbības;

2.4. akvakultūras nozares uzņēmuma operators – fiziska vai juridiska persona, kas ir atbildīga par šajos noteikumos noteikto prasību ievērošanu tās kontrolē esošajā akvakultūras uzņēmumā;

2.5. atzīta pārstrādes uzņēmuma operators – fiziska vai juridiska persona, kas ir atbildīga par šajos noteikumos noteikto prasību ievērošanu atzītā pārstrādes uzņēmumā;

2.6. atzīts pārstrādes uzņēmums – pārtikas uzņēmums, kas saskaņā ar Eiropas Parlamenta un Padomes 2004. gada 29. aprīļa Regulas (EK) Nr. 853/2004, ar ko nosaka īpašus higiēnas noteikumus attiecībā uz dzīvnieku izcelsmes pārtiku (turpmāk – regula (EK) Nr. 853/2004), 4. pantu atzīts akvakultūras dzīvnieku pārstrādei un kam piešķirts atzīšanas numurs;

2.7. audzētava – akvakultūras nozares uzņēmumā esoša telpa, iežogota platība uzņēmuma teritorijā vai iekārta, kurā akvakultūras dzīvnieki tiek audzēti, lai tos piedāvātu tirgū, izņemot telpu, iežogotu platību vai iekārtu, kurā savvaļā noķertos vai ievāktos ūdensdzīvniekus tur nebarotus līdz to nokaušanai un pārtikas produktu iegūšanai;

2.8. audzētava makšķerēšanai – dīķis vai cita ierīkota ūdenskrātuve, kurā dzīvnieku populāciju uztur amatierzvejai, atjaunojot krājumus ar akvakultūras dzīvniekiem;

2.9. audzēšana – akvakultūras dzīvnieku audzēšana audzētavā vai divvāku molusku audzēšanas zonā;

2.10. audzēšanas zona – saldūdens, jūras, grīvas, kontinentāla vai lagūnas teritorija ar dabiskām divvāku molusku gultnēm vai vietām, ko izmanto divvāku molusku audzēšanai un no kurām iegūst divvāku moluskus;

2.11. buferzona – zona ap inficētu zivju audzētavu vai divvāku molusku audzēšanas zonu, kurā tiek īstenoti slimību kontroles pasākumi, lai novērstu slimības izplatīšanos;

2.12. dekoratīvs ūdensdzīvnieks – ūdensdzīvnieks, kuru tur, audzē vai piedāvā tirgū dekoratīviem mērķiem;

2.13. divvāku molusku audzēšanas zona – ražošanas vai izklāšanas zona, kurā visi akvakultūras nozares uzņēmumi darbojas kopējā bioloģiskās drošības sistēmā;

2.14. Eiropas Savienības dabiskie ūdeņi – Eiropas Savienības dalībvalstu robežās esošas dabiskā ceļā izveidojušās (bez cilvēku palīdzības) ūdensteces (upes, strauti, kanāli vai to daļas), ūdenstilpes (ezeri, dīķi, ūdenskrātuves vai to daļas), kā arī pārejas ūdeņi vai piekrastes ūdeņu posmi;

2.15. epizootoloģiska vienība – ūdensdzīvnieku grupa, kuru konkrētā teritorijā apdraud viens slimības ierosinātājs. Apdraudējumu var radīt kopīga ūdens vide vai pārvaldības prakse, kas rada iespēju vienas dzīvnieku grupas slimības izraisītājam strauji pāriet uz citu dzīvnieku grupu;

2.16. iecirknis – epizootoloģisku vienību veidojoša viena vai vairākas audzētavas vai molusku audzēšanas zonas, uz kurām attiecināma kopēja bioloģiskās drošības sistēma un kurās esošajiem ūdensdzīvniekiem ir konkrēts veselības stāvoklis attiecībā uz konkrētas slimības sastopamību vai ūdensdzīvnieku veselības stāvoklis saistībā ar konkrētu infekcijas slimības ierosinātāju ir atkarīgs no veselības stāvokļa attiecībā uz šo infekcijas slimību ierosinātāju apkārtējos dabiskajos ūdeņos;

2.17. infekcija – tāda slimības ierosinātāja klātbūtne pārnēsātājā sugā, kas vairojas vai citādi attīstās, vai ir latentā stāvoklī;

2.18. inficēta zona, inficēts iecirknis – zona vai iecirknis, kur konstatēta infekcijas slimība;

2.19. jauna slimība – nesen konstatēta slimība, kuras cēlonis var būt un var nebūt noteikts un kura var izplatīties populācijā un starp populācijām (piemēram, tirgojoties ar ūdensdzīvniekiem vai šo dzīvnieku produktiem). Tā ir arī jau pazīstama slimība, kas identificēta jaunā pārnēsātājā sugā, kura nav iekļauta šo noteikumu 1. pielikumā kā uzņēmīga suga;

2.20. karantīna – ūdensdzīvnieku grupas turēšana izolēti, novēršot tiešu vai netiešu kontaktu ar citiem ūdensdzīvniekiem. Izolāciju veic, lai noteiktā laikposmā šo grupu novērotu, veiktu attiecīgas analīzes, apstrādi un notekūdeņu attīrīšanu;

2.21. karantīnas punkts – norobežotas telpas, to komplekss vai platība, kurā nodrošina akvakultūras dzīvnieku karantīnu. Karantīnas punktā ir viena vai vairākas karantīnas vienības, un tas ir reģistrēts Eiropas Parlamenta un Padomes 2004. gada 29. aprīļa Regulas (EK) Nr. 882/2004 par oficiālo kontroli, ko veic, lai nodrošinātu atbilstības pārbaudi saistībā ar dzīvnieku barības un pārtikas aprites tiesību aktiem un dzīvnieku veselības un dzīvnieku labturības noteikumiem (turpmāk – regula (EK) Nr. 882/2004), 2. panta 4. punkta nozīmē atbilstoši šo noteikumu 129. un 130. punktā minētajām prasībām;

2.22. karantīnas vienība – darbībā un telpā norobežota karantīnas punkta daļa, kurā atrodas viena sūtījuma akvakultūras dzīvnieki ar vienādu veselības stāvokli un akvakultūras kontroldzīvnieki, ja nepieciešams;

2.23. kontinentāla audzētava – akvakultūras dzīvnieku audzētava, kurā tur ūdensdzīvniekus un kura atrodas kādas Eiropas Savienības dalībvalsts teritorijas kontinentālajā daļā, kas ietver:

2.23.1. visu sateces baseinu no ūdensteču iztekām līdz estuāram vai vairāk nekā vienu sateces baseinu, kurā zivis tiek audzētas, turētas vai zvejotas un ko var aptvert buferzona;

2.23.2. daļu sateces baseina no ūdensteču iztekas līdz dabīgam vai mākslīgam aizsprostam, kas novērš zivju migrāciju no ūdensteces daļas lejpus aizsprosta un ko var aptvert buferzona;

2.24. kontinentāla zona – zona, kurā ietilpst vienas vai vairāku Eiropas Savienības dalībvalstu kontinentālajā daļā esošas ģeogrāfiski precīzas teritorijas ar homogēnu hidroloģisko sistēmu, kas aptver ūdens sateces teritorijas daļas no iztekas līdz dabiskam vai mākslīgam šķērslim, kurš nepieļauj akvakultūras dzīvnieku augšupēju migrēšanu no zemākiem ūdens sateces teritorijas posmiem, vai visu ūdens sateces teritoriju no iztekas līdz grīvai, vai arī vairākas ūdens sateces teritorijas kopā ar to grīvām (jo grīva rada epizootoloģisku saikni starp sateces teritorijām);

2.25. kontinentāls iecirknis – iecirknis ar vienu vai vairākām audzētavām, kuras atrodas vienas vai vairāku Eiropas Savienības dalībvalstu kontinentālajā daļā, kurām ir izstrādāta kopīga bioloģiskās drošības sistēma un kurās ir akvakultūras dzīvnieku populācija ar noteiktu veselības stāvokli attiecībā uz konkrētu slimību;

2.26. komerciāls izmērs – akvakultūras dzīvnieka svars un ķermeņa lielums, kādā ir racionāli nogalināt akvakultūras dzīvnieku pārstrādei, lai iegūtu pārtikas produktus;

2.27. kopēja bioloģiskās drošības sistēma – sistēma, kuras ietvaros tiek piemēroti vienādi dzīvnieku veselības uzraudzības, slimību profilakses un slimību kontroles pasākumi;

2.28. mirstības pieaugums – ūdensdzīvnieku nāves gadījumi, ja kopējā mirstība būtiski pārsniedz tādu līmeni, ko noteiktos apstākļos uzskata par normālu audzētavai vai divvāku molusku audzēšanas zonai. Par to, kas ir mirstības pieaugums, lemj audzētājs kopā ar Pārtikas un veterinārā dienesta (turpmāk – dienests) amatpersonu;

2.29. neizmantošana – slimību kontroles pasākumi, kuru laikā audzētava tiek atbrīvota no ūdens, kurā mituši akvakultūras dzīvnieki, vai audzētavas atbrīvošana no akvakultūras dzīvniekiem, kas ir uzņēmīgi pret noteiktu slimības ierosinātāju vai spēj pārnēsāt šīs slimības ierosinātāju;

2.30. oficiāli deklarēta inficēta audzētava – tāda akvakultūras dzīvnieku audzētava, kurā dienests ir apstiprinājis vienas vai vairāku šo noteikumu 1. pielikuma II daļā minēto akvakultūras dzīvnieku neeksotisko infekcijas slimību esību;

2.31. piedāvāšana tirgū – pārdošana, piedāvājums pārdot vai jebkura cita īpašuma tiesību nodošana bez maksas vai par maksu, kā arī jebkāda akvakultūras dzīvnieku kustība, kas nodrošina minēto īpašuma tiesību īstenošanu;

2.32. saskarē esoša audzētava – audzētava, kurā tiek turēti akvakultūras dzīvnieki, par kuriem jebkādā veidā ir pierādīts vai ir aizdomas, ka tie ir inficēti (kontaminēti) ar infekciozu materiālu no oficiāli deklarētas inficētas audzētavas;

2.33. savvaļas ūdensdzīvnieks – Agnatha virsklases ūdensdzīvnieki, Chondrichthyes un Osteichthyes klases zivis, Phylum Mollusca divvāku moluski, Subphylum Crustacea vēžveidīgie, kas dzīvo savvaļā un nav akvakultūras dzīvnieki;

2.34. slimība – ūdensdzīvnieku inficēšanās ar vienu vai vairākiem slimības ierosinātājiem, kura noris ar klīniskām pazīmēm vai bez tām;

2.35. slimības neskarta zona vai iecirknis – zona vai iecirknis, kuru dienests ir pasludinājis par slimības neskartu;

2.36. slimības pārnēsātājs – dzīvnieku suga, kas nav uzņēmīga pret slimības ierosinātāju, bet spēj izplatīt infekciju, nododot patogēnus no vienas dzīvnieku sugas otrai;

2.37. transporta barotne – barotne ar šūnu kultūru, kurā ir 10 % teļa seruma un 200 SV penicilīna, 200 μg streptomicīna un 200 μg kanamicīna uz vienu mililitru barotnes vai citas antibiotikas ar pierādītu iedarbīgumu;

2.38. tradicionālā ekstensīvā lagūnu akvakultūras prakse – gliemju audzēšana seklā jūras, grīvas vai lagūnas līcī, ko no jūras vai okeāna atdala smilšu sēres un kura robežas ir skaidri noteiktas un iezīmētas ar bojām, stabiem vai citiem fiksētiem līdzekļiem, ja šo teritoriju izmanto tikai dzīvu gliemju dabiskai attīrīšanai;

2.39. turpmāka pārstrāde – akvakultūras dzīvnieku pārstrāde pirms lietošanas pārtikā, ko veic, izmantojot metodes un tehnoloģijas, kuras ietekmē anatomisko veselumu (piemēram, asiņu notecināšana, ķidāšana, galvas nogriešana, griešana šķēlēs, filejas atdalīšana) un kuras rada atkritumus vai blakusproduktus, kas var radīt slimību izplatīšanās risku;

2.40. uzņēmīga suga – dzīvnieku suga, kurai inficēšanās ar infekcijas slimības ierosinātāju ir konstatēta dabīgā ceļā vai tiek pierādīta eksperimentāli, atveidojot dabīgos inficēšanās ceļus;

2.41. ūdensdzīvnieki – Agnatha virsklases, Chondrichthyes un Osteichthyes klases zivis, Phylum Mollusca divvāku moluski, Subphylum Crustacea vēžveidīgie;

2.42. veselības sertifikācija (izvērtēšana) – dienesta darbības, lai novērtētu akvakultūras dzīvnieku veselības stāvokli atbilstoši šo noteikumu prasībām un noteiktu infekcijas slimības izplatīšanās riskus. Veselības sertifikācijas (izvērtēšanas) mērķis ir droša akvakultūras dzīvnieku pārvietošana, kuras dēļ nerodas infekcijas slimības pārnešana uz citām audzētavām Latvijas valsts teritorijā, zonā vai iecirknī vai uz citu Eiropas Savienības dalībvalstu teritorijām;

2.43. zona – precīza ģeogrāfiska teritorija ar homogēnu hidroloģisko sistēmu, ko veido ūdens sateces laukuma daļa no tās avota līdz dabiskai vai mākslīgai barjerai, kura novērš ūdensdzīvnieku migrāciju uz augšu no zemākiem ūdens sateces laukuma posmiem, vai viss ūdens sateces laukums no avota līdz ietekai, vai vairāki ūdens sateces laukumi, arī to ietekas, ja tās epizootoloģiski saistās ar ūdens sateces laukumu.

3. Noteikumi neattiecas uz:

3.1. dekoratīvajiem ūdensdzīvniekiem, kurus audzē akvārijos nekomerciālā nolūkā;

3.2. savvaļas ūdensdzīvniekiem, kurus noķer vai savāc izmantošanai pārtikas apritē;

3.3. ūdensdzīvniekiem, kurus noķer, lai no tiem iegūtu zivju miltus, zivju barību, zivju eļļu un citus līdzīgus produktus.

4. Šo noteikumu 5., 6., 7., 8., 9., 10., 11., 12., 13. un 14. punkts, III, IV un XIII nodaļa neattiecas uz dekoratīvajiem ūdensdzīvniekiem, kurus komerciālā nolūkā tur zooveikalos, dārzu centros, dārzu dīķos, akvārijos vai kurus tur vairumtirgotāji, nodrošinot, lai:

4.1. ūdensdzīvnieki nenonāktu kontaktā ar Eiropas Savienības dabiskajiem ūdeņiem;

4.2. notekūdeņu attīrīšanas iekārtas, kas uzstādītas ūdensdzīvnieku turēšanas vietās, samazinātu līdz minimumam infekcijas slimību iekļūšanas iespējamību Eiropas Savienības dabiskajos ūdeņos.

5. Noteikumu uzraudzību un kontroli veic dienests saskaņā ar regulas (EK) Nr. 882/2004 3. pantu. Uzraudzība un kontrole ietver regulāras inspekcijas, apmeklējumus, revīzijas un, ja nepieciešams, paraugu ņemšanu katrā akvakultūras nozares uzņēmumā, ņemot vērā riskus, kas var rasties, akvakultūras dzīvniekiem inficējoties ar infekcijas slimībām. Dienests uzraudzību un kontroli veic šo noteikumu XV nodaļā un 2. pielikumā noteiktajā kārtībā.

II. Akvakultūras nozares uzņēmumu un akvakultūras pārstrādes uzņēmumu atzīšanas uz reģistrācijas kārtība un kārtība, kādā uzņēmumu operatori sniedz dienestā nepieciešamo informāciju

6. Fiziskā vai juridiskā persona iesniedz dienestā iesniegumu:

6.1. lai reģistrētu:

6.1.1. iekārtas un aprīkojumu, kas nav atzīts par akvakultūras nozares uzņēmumu, ja ūdensdzīvnieki tajā tiek turēti bez nodoma piedāvāt tos tirgū (šī prasība neattiecas uz privātpersonu īpašumā esošiem akvārijiem);

6.1.2. akvakultūras nozares uzņēmumus, kas piedāvā tirgū akvakultūras dzīvniekus lietošanai pārtikā saskaņā ar regulas (EK) Nr. 853/2004 1. panta 3. punkta "c" apakšpunktu;

6.2. lai atzītu:

6.2.1. akvakultūras nozares uzņēmumu individuāli;

6.2.2. akvakultūras nozares uzņēmumus grupā;

6.2.3. pārstrādes uzņēmumu individuāli.

7. Pēc šo noteikumu 6. punktā minētā iesnieguma saņemšanas dienests:

7.1. piešķir reģistrācijas numuru šo noteikumu 6.1. apakšpunktā minētajiem uzņēmumiem, sastāda reģistrēto uzņēmumu sarakstu un ievieto šo informāciju tīmekļvietnē;

7.2. izvērtē šo noteikumu 6.2. apakšpunktā minētos uzņēmumus atbilstoši šo noteikumu 8. punktā minētajām prasībām. Ja ir pieņemts pozitīvs lēmums, piešķir atzīšanas numuru, sastāda atzīto uzņēmumu sarakstu un ievieto šo informāciju tīmekļvietnē.

8. Dienests atzīšanas numuru piešķir tādiem akvakultūras nozares uzņēmumiem vai pārstrādes uzņēmumiem, kuri:

8.1. ir izveidojuši un ieviesuši pasākumu kopumu, kas nodrošina šajos noteikumos minēto prasību izpildi;

8.2. atrodas dienesta uzraudzībā;

8.3. pilda šo noteikumu 15., 16., 17., 18., 19., 20. un 21. punktā minētās prasības;

8.4. tur vai audzē akvakultūras dzīvniekus. Ja akvakultūras nozares uzņēmums tiek atzīts kā jauns uzņēmums, akvakultūras nozares uzņēmuma operators uzrāda līgumu par akvakultūras dzīvnieku piegādi vai līdzvērtīgu informāciju, kas apliecina, ka akvakultūras nozares uzņēmums nākotnē nodarbosies ar akvakultūras dzīvnieku audzēšanu vai turēšanu;

8.5. pārstrādā akvakultūras dzīvniekus.

9. Dienests veic akvakultūras nozares uzņēmumu atzīšanu individuāli un piešķir atzīšanas numuru. Vairākus akvakultūras nozares uzņēmumus, ja tajos iegūst divvāku moluskus un ja šie akvakultūras nozares uzņēmumi atrodas vienā divvāku molusku audzēšanas zonā, var atzīt grupā. Grupā atzītiem vairākiem akvakultūras nozares uzņēmumiem piešķir vienu atzīšanas numuru. Divvāku molusku nosūtīšanas centrus, attīrīšanas centrus un līdzīgus akvakultūras nozares uzņēmumus atzīst individuāli.

10. Dienests veic pārstrādes uzņēmuma atzīšanu individuāli un piešķir atzīšanas numuru, ja attiecīgais pārstrādes uzņēmums nodarbojas ar akvakultūras dzīvnieku kaušanu, lai kontrolētu slimību izplatīšanos.

11. Dienests akvakultūras nozares uzņēmumu vai pārstrādes uzņēmumu neatzīst un atzīšanas numuru nepiešķir, ja uzņēmumu darbība var radīt nepieļaujamu risku infekcijas slimību izplatībai uz citām audzētavām, divvāku molusku audzēšanas zonām vai šo uzņēmumu tuvumā esošiem savvaļas ūdensdzīvnieku resursiem. Dienesta amatpersona pirms lēmuma pieņemšanas par atzīšanas procesa pārtraukšanu un atzīšanas numura nepiešķiršanu, ņemot vērā epizootoloģisko situāciju akvakultūras nozares uzņēmumā vai pārstrādes uzņēmumā, nosaka riska mazināšanas pasākumus, kā arī attiecīgās darbības organizēšanu citā vietā. Dienesta amatpersona atzīšanas numuru piešķir, ja akvakultūras nozares uzņēmuma vai pārstrādes uzņēmuma operators veic visus infekcijas slimību izplatīšanās riska mazināšanas pasākumus.

12. Akvakultūras nozares uzņēmuma operators iesniedz dienestā un dienests ievada attiecīgajā tīmekļvietnē šādu publiski pieejamu informāciju:

12.1. akvakultūras nozares uzņēmuma nosaukums, adrese un kontaktinformācija (tālruņa, faksa numurs un e-pasta adrese);

12.2. akvakultūras nozares uzņēmuma reģistrācijas numurs vai atzīšanas numurs;

12.3. akvakultūras nozares uzņēmuma (audzētavas) ģeogrāfiskais stāvoklis (izmanto piemērotu koordinātu sistēmu par visām audzētavām (GIS koordinātas));

12.4. akvakultūras nozares uzņēmuma (audzētavas) mērķis un audzēšanas tips (kultūras sistēmas vai iekārtu tips), maksimālais ražošanas apjoms, ja tas tiek regulēts;

12.5. par audzētavas ūdens piegādi un izplūdi – kontinentālajām audzētavām, kā arī nosūtīšanas un attīrīšanas centriem;

12.6. akvakultūras nozares uzņēmumā (audzētavā) audzēto akvakultūras dzīvnieku sugas. Audzētavas, kuras audzē vairākas akvakultūras dzīvnieku sugas, vai dekoratīvo ūdensdzīvnieku audzētavas norāda, vai kāda no šīm sugām ir uzņēmīga pret šo noteikumu 1. pielikumā minētajām infekcijas slimībām vai ir šo slimību pārnēsātāja;

12.7. ja divvāku molusku audzēšanas zonai atzīšanas numurs piešķirts grupā, šo noteikumu 12.1., 12.2., 12.3, 12.4., 12.5. un 12.6. apakšpunktā minēto informāciju iesniedz par visiem akvakultūras nozares uzņēmumiem, kas darbojas vienā divvāku molusku audzēšanas zonā.

13. Dienests tīmekļvietnē ievada šādu publiski pieejamu informāciju par akvakultūras nozares uzņēmumu:

13.1. akvakultūras dzīvnieku veselības stāvoklis (piemēram, vai audzētava ir infekcijas slimības neskarta). Informāciju ievada divu nedēļu laikā pēc dienesta veiktās pārbaudes;

13.2. vai audzētavā ir ieviesta infekcijas slimību kontroles programma, lai sasniegtu infekcijas slimības neskartas audzētavas statusu. Informāciju ievada divu nedēļu laikā pēc programmas ieviešanas sākuma;

13.3. vai audzētava ir pasludināta par inficētu ar kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām. Informāciju ievada nekavējoties pēc audzētavas pasludināšanas par inficētu.

14. Pārstrādes uzņēmuma operators iesniedz dienestā un dienests ievada tīmekļvietnē šādu publiski pieejamu informāciju:

14.1. pārstrādes uzņēmuma nosaukums, adrese un kontaktinformācija (tālruņa, faksa numurs un e-pasta adrese);

14.2. pārstrādes uzņēmuma reģistrācijas numurs vai atzīšanas numurs;

14.3. pārstrādes uzņēmuma ģeogrāfiskais stāvoklis (izmanto piemērotu koordinātu sistēmu (GIS koordinātas));

14.4. pārstrādes uzņēmuma notekūdeņu attīrīšanas sistēmas (notekūdeņu attīrīšanas veids, notekūdeņu attīrīšanas sistēmas uzbūve, laboratoriskie izmeklējumi par izplūstošo attīrīto notekūdeņu kvalitāti, atkritumproduktu (ja tādi ir) iznīcināšanas vieta);

14.5. pārstrādes uzņēmumā pārstrādātās akvakultūras dzīvnieku sugas.

III. Akvakultūras nozares uzņēmuma operatora, pārstrādes uzņēmuma operatora un pārvadātāja kompetence

15. Akvakultūras nozares uzņēmuma operators veic šādu datu uzskaiti:

15.1. visu veidu akvakultūras dzīvnieku un to produktu kustība uz audzētavu vai divvāku molusku audzēšanas zonu un no tās;

15.2. mirstība katrā epizootoloģiskajā vienībā atbilstoši ražošanas veidam;

15.3. akvakultūras dzīvnieku veselības uzraudzības rezultāti, kas iegūti saskaņā ar šo noteikumu 20. un 21. punktu.

16. Atzīta pārstrādes uzņēmuma operators veic uzskaiti par visu akvakultūras dzīvnieku un to produktu kustību uz uzņēmumu un no tā.

17. Pārvadājot akvakultūras dzīvniekus, pārvadātājs veic šādu datu uzskaiti:

17.1. akvakultūras dzīvnieku mirstība pārvadāšanas laikā atbilstoši transporta veidam un pārvadājamo dzīvnieku sugai;

17.2. akvakultūras dzīvnieku pārvadāšanas laikā apmeklētās audzētavas, divvāku molusku audzēšanas zonas un pārstrādes uzņēmumi;

17.3. ūdens ņemšanas vietas un ūdens izliešanas vietas, kā arī pārvadāšanas laikā veiktā ūdens nomaiņa.

18. Akvakultūras nozares uzņēmuma operators šo noteikumu 15.1. apakšpunktā minēto uzskaiti veic, nodrošinot izcelsmes vietas un galamērķa vietas izsekojamību.

19. Akvakultūras nozares uzņēmuma operators un atzīta pārstrādes uzņēmuma operators uzņēmumā seko normatīvo aktu ievērošanai higiēnas jomā, lai novērstu infekcijas slimību ievešanu un izplatību.

20. Visās audzētavās un divvāku molusku audzēšanas zonās akvakultūras nozares uzņēmuma operators slēdz līgumu ar praktizējošu veterinārārstu, lai izveidotu un īstenotu akvakultūras dzīvnieku veselības uzraudzības shēmu atbilstoši šo noteikumu 2. pielikumam.

21. Šo noteikumu 20. punktā minēto akvakultūras dzīvnieku veselības uzraudzības shēmu veido tā, lai konstatētu:

21.1. mirstības pieaugumu visās audzētavās un divvāku molusku audzēšanas zonās atbilstoši ražošanas veidam;

21.2. šo noteikumu 1. pielikumā minētās infekcijas slimības, kā arī pret tām uzņēmīgās akvakultūras dzīvnieku sugas.

IV. Veterinārās prasības akvakultūras dzīvnieku un no tiem iegūtu produktu piedāvāšanai tirgū

22. Šajā nodaļā noteiktās prasības attiecas uz šo noteikumu 1. pielikumā minētajām infekcijas slimībām un uzņēmīgajām akvakultūras dzīvnieku sugām. Akvakultūras dzīvnieku īpašnieks vai turētājs nodrošina, lai akvakultūras dzīvnieku un to produktu laišana tirgū neapdraudētu ūdensdzīvnieku veselības stāvokli saistībā ar šo noteikumu 1. pielikumā minētajām akvakultūras dzīvnieku infekcijas slimībām (lai netiktu izplatītas akvakultūras dzīvnieku infekcijas slimības ūdensdzīvnieku populācijā).

23. Akvakultūras dzīvniekus un to produktus, kuri neatbilst šajā nodaļā noteiktajām prasībām, atļauts piedāvāt tirgū izmantošanai zinātniskiem mērķiem (pētījumi, testi un citas līdzvērtīgas darbības, lai veiktu izpēti, kas nav saistīta ar dzīvu akvakultūras dzīvnieku un no tiem iegūtu pārtikas produktu iegūšanu un izplatīšanu pārtikas apritē). Dienests veic šādu dzīvnieku periodisku kontroli, lai tās laikā novērotu, vai akvakultūras dzīvnieki nerada pastiprinātus infekcijas slimību izplatīšanās draudus galamērķa teritorijā vai tranzīta punktos.

24. Šo noteikumu 23. punktā minētos akvakultūras dzīvniekus atļauts izplatīt Eiropas Savienības dalībvalstīs, ja iesaistīto dalībvalstu kompetentās institūcijas, kas kontrolē akvakultūras dzīvnieku infekcijas slimības, ir informētas par šādu akvakultūras dzīvnieku pārvadāšanu un tirdzniecību ar tiem.

25. Akvakultūras dzīvnieku pārvadāšanas laikā:

25.1. veic infekcijas slimību profilakses pasākumus, lai pārvadāšanas laikā nemainītos pārvadājamo akvakultūras dzīvnieku veselības stāvoklis un samazinātu infekcijas slimību izplatīšanās iespēju;

25.2. nodrošina apstākļus, kas neapdraud galamērķa teritorijā un tranzīta punktos dzīvojošo akvakultūras dzīvnieku veselības stāvokli;

25.3. ūdens nomaiņu veic tādās vietās un apstākļos, kas neapdraud pārvadājamo akvakultūras dzīvnieku veselības stāvokli, ūdensdzīvnieku veselības stāvokli ūdens nomaiņas vietā un ūdensdzīvnieku veselības stāvokli galamērķa vietā. Ūdens nomaiņas vietā ievēro šādas prasības:

25.3.1. izmantoto ūdeni pakļauj apstrādei, kuras laikā tiek iznīcināti infekcijas slimību ierosinātāji, un pēc ūdens nonākšanas apkārtējā vidē netiek ietekmēts ūdensdzīvnieku veselības stāvoklis;

25.3.2. nomaināmais ūdens nesatur infekcijas slimību ierosinātājus, kas var inficēt pārvadājamos akvakultūras dzīvniekus un dzīvniekus galamērķa teritorijā.

26. Akvakultūras dzīvnieku īpašnieks vai turētājs nodrošina tādu akvakultūras dzīvnieku nonākšanu Latvijas tirgū (ievešanu Latvijas valsts teritorijā, zonā vai iecirknī, kas pasludināts par infekcijas slimības neskartu vai uz ko attiecas infekcijas slimības uzraudzības vai apkarošanas programma), kuriem ir atbilstošs veselības stāvoklis (akvakultūras dzīvniekiem to izcelsmes Eiropas Savienības dalībvalsts kompetentā iestāde ir veikusi veselības sertificēšanu (izvērtēšanu) un tiem ir izsniegts veterinārais (veselības) sertifikāts vai tie ir atzīti par derīgiem tālākai izplatīšanai, neradot risku izplatīt infekcijas slimību ierosinātājus), ja šie dzīvnieki tiek izmantoti kādam no turpmāk minētajiem mērķiem:

26.1. audzēšanai vai krājumu atjaunošanai;

26.2. turpmākai apstrādei pirms lietošanas pārtikā (izņemot nokautas un no iekšējiem orgāniem atbrīvotas (ķidātas) zivis vai divvāku moluskus un vēžveidīgos, kas ir nosūtīti kā neapstrādāti vai apstrādāti produkti).

27. Dienests akvakultūras dzīvnieku veselības sertifikāciju (izvērtēšanu) veic pirms to piedāvāšanas tirgū, ja akvakultūras dzīvnieki atrodas šo noteikumu 54., 55., 56., 57., 58., 59., 60., 61., 62., 63., 64., 65., 66., 67. un 68. punktā noteiktajiem kontroles un apkarošanas pasākumiem pakļautajā zonā. Ja akvakultūras dzīvnieku veselības sertifikācijas (izvērtēšanas) procesā ir pieņemts pozitīvs lēmums, dienests akvakultūras dzīvnieku kravai izsniedz veterināro (veselības) sertifikātu, kas ir atļauja izplatīt akvakultūras dzīvniekus ārpus šo noteikumu VII, VIII un IX nodaļā noteiktajām slimību kontroles un apkarošanas pasākumu zonām uz citām Eiropas Savienības dalībvalstīm.

28. Dienests par akvakultūras dzīvnieku kustību paziņo datorizētajā sistēmā (Eiropas Savienības elektroniskās informācijas apmaiņas sistēma), ja:

28.1. pārvadāšanai nepieciešams veterinārais (veselības) sertifikāts un akvakultūras dzīvniekus pārvieto no Latvijas valsts teritorijas uz citu Eiropas Savienības dalībvalsti;

28.2. pārvadāšanai nav nepieciešams veterinārais (veselības) sertifikāts un dzīvus akvakultūras dzīvniekus pārvadā no Latvijas valsts teritorijas uz citu Eiropas Savienības dalībvalsti audzēšanai vai krājumu atjaunošanai.

29. Akvakultūras dzīvnieku īpašnieks vai turētājs nodrošina, lai akvakultūras dzīvnieki, ko piedāvā tirgū audzēšanai:

29.1. būtu klīniski veseli;

29.2. netiktu iegūti audzētavā vai divvāku molusku audzēšanas zonā, kur konstatēti nenoskaidroti paaugstinātas mirstības gadījumi, izņemot gadījumu, ja ir veikta infekcijas slimību izplatīšanās riska izvērtēšana un akvakultūras dzīvnieki tiek iegūti audzētavas daļā vai divvāku molusku audzēšanas zonā, kas ir neatkarīga no epizootoloģiskās vienības, kurā noticis mirstības pieaugums.

30. Nav atļauts piedāvāt tirgū audzēšanai vai krājumu atjaunošanai akvakultūras dzīvniekus, kas iegūti akvakultūras nozares uzņēmumā, kurā konstatēts akvakultūras dzīvnieku infekcijas slimības uzliesmojums vai ir aizdomas par šādas infekcijas slimības klātbūtni.

31. Akvakultūras dzīvnieku īpašnieks vai turētājs nodrošina, lai akvakultūras dzīvnieki, kurus piedāvā krājumu atjaunošanai savvaļā un audzētavās makšķerēšanai:

31.1. būtu klīniski veseli;

31.2. nebūtu iegūti audzētavā vai divvāku molusku audzēšanas zonā, kur konstatēti nenoskaidroti paaugstinātas mirstības gadījumi, izņemot gadījumu, ja veikta infekcijas slimību izplatīšanās riska izvērtēšana un akvakultūras dzīvnieki tiek iegūti audzētavas daļā vai divvāku molusku audzēšanas zonā, kas ir neatkarīga no epizootoloģiskās vienības, kurā noticis mirstības pieaugums;

31.3. būtu iegūti audzētavā vai divvāku molusku audzēšanas zonā, kuras veselības stāvoklis ir līdzvērtīgs to ūdeņu veselības stāvoklim, kur akvakultūras dzīvniekus izlaidīs, vai akvakultūras dzīvnieki būtu iegūti zonā vai iecirknī, kas saskaņā ar šo noteikumu XIII un XIV nodaļā noteiktajām prasībām ir pasludināts par infekcijas slimības neskartu.

32. Lai Latvijas valsts teritorijā, zonā vai iecirknī, kas pasludināts par konkrētas infekcijas slimības neskartu zonu vai iecirkni (izpildītas šo noteikumu XIII un XIV nodaļā minētās prasības), varētu ievest pret šo slimību uzņēmīgus akvakultūras dzīvniekus audzēšanai vai krājumu atjaunošanai, ievedamo akvakultūras dzīvnieku izcelsmes vietai jābūt tādai Eiropas Savienības dalībvalstij, zonai vai iecirknim, kas ir pasludināts par konkrētās infekcijas slimības neskartu.

33. Šo noteikumu 32. punktā minēto nosacījumu nepiemēro, ja zinātniski pierādīts, ka pret konkrēto infekcijas slimības ierosinātāju uzņēmīgās akvakultūras dzīvnieku sugas noteiktās attīstības stadijās šo slimību nepārnēsā.

34. Dienests veic kontroli akvakultūras dzīvnieku sugām, kas nav minētas šo noteikumu 1. pielikumā, ja saskaņā ar zinātniskiem pētījumiem vai praktisko pieredzi iegūtie dati apliecina, ka attiecīgās sugas akvakultūras dzīvnieki var pārnest kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām.

35. Šo noteikumu 34. punktā minētos akvakultūras dzīvniekus atļauts ievest audzēšanai vai krājumu atjaunošanai zonā vai iecirknī, kas pasludināts par konkrētās infekcijas slimības neskartu, ja ir izpildīts viens no šādiem nosacījumiem:

35.1. infekcijas slimību pārnēsātājas dzīvnieku sugas izcelsmes vieta ir tāda Eiropas Savienības dalībvalsts, zona vai iecirknis, kas ir pasludināts par konkrētās infekcijas slimības neskartu;

35.2. infekcijas slimības pārnēsātājas dzīvnieku sugas tur karantīnas iekārtā vai ūdenī, līdz tiek novērsta infekcijas slimības pārnešanas iespējamība. Infekcijas slimības pārnēsātājas dzīvnieku sugas tur ūdenī, kurā nav sastopams konkrētais infekcijas slimības ierosinātājs. Karantīnas periods nedrīkst būt mazāks par divām nedēļām.

36. Akvakultūras dzīvniekus, kas ir uzņēmīgi pret kādu no šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām, un šādu akvakultūras dzīvnieku produktus atļauts piedāvāt tirgū turpmākai apstrādei Latvijas valsts teritorijā, zonā vai iecirknī, kas ir pasludināts par konkrētās infekcijas slimības neskartu, ja šie akvakultūras dzīvnieki un to produkti atbilst vienam no šādiem nosacījumiem:

36.1. akvakultūras dzīvnieku izcelsmes vieta ir Eiropas Savienības dalībvalsts, zona vai iecirknis, kas ir pasludināts par konkrētās infekcijas slimības neskartu;

36.2. akvakultūras dzīvnieku produkti ir pārstrādāti atzītā pārstrādes uzņēmumā higiēniski tīros apstākļos atbilstoši normatīvajos aktos par pārtikas produktu higiēnu noteiktajām prasībām un nepieļauj infekcijas slimību izplatīšanos;

36.3. zivis pirms nosūtīšanas ir nokautas un izķidātas;

36.4. divvāku moluski un vēžveidīgie no to izcelsmes vai pirmapstrādes vietas tiek nosūtīti kā neapstrādāti vai pārstrādāti produkti.

37. Dzīvus akvakultūras dzīvniekus, kas ir uzņēmīgi pret kādu no šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām, piedāvāt tirgū turpmākai pārstrādei Latvijas valsts teritorijā, zonā vai iecirknī, kas ir pasludināts par konkrētās infekcijas slimības neskartu, atļauts, ja tos uzglabā pārstrādes vietā ne ilgāk kā septiņas dienas un ir izpildīts viens no šādiem nosacījumiem:

37.1. akvakultūras dzīvnieku izcelsmes vieta ir Eiropas Savienības dalībvalsts, zona vai iecirknis, kas pasludināts par konkrētās infekcijas slimības neskartu;

37.2. akvakultūras dzīvniekus ne ilgāk kā vienu mēnesi tur nosūtīšanas centrā vai attīrīšanas centrā, kas aprīkots ar notekūdeņu attīrīšanas sistēmu, kura ir spējīga dezaktivēt konkrētos patogēnus vai kuras notekūdeņi ir pakļauti apstrādei, kas samazina iespējamību pārnest slimību uz dabiskajām ūdenstilpēm.

38. Akvakultūras dzīvniekus, kuri uzņēmīgi pret šo noteikumu 1. pielikumā minētajām infekcijas slimībām, kā arī šo akvakultūras dzīvnieku produktus, kurus piedāvā tirgū lietošanai pārtikā bez turpmākās apstrādes, iesaiņo mazumtirdzniecības iesaiņojumā, kas atbilst regulā (EK) Nr. 853/2004 minētajiem noteikumiem par iesaiņojumu un marķēšanu.

39. Dzīvus divvāku moluskus un vēžveidīgos, kuri ir uzņēmīgi pret kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām, atļauts uz laiku izlaist Eiropas Savienības akvakultūras audzētavās, ievest nosūtīšanas centros, attīrīšanas centros vai līdzīgos uzņēmumos, ja moluskus un vēžveidīgos uzglabā pārstrādes vietā ne ilgāk kā septiņas dienas un ir izpildīts viens no šādiem nosacījumiem:

39.1. akvakultūras dzīvnieku izcelsmes vieta ir Eiropas Savienības dalībvalsts, zona vai iecirknis, kas pasludināts par konkrētās infekcijas slimības neskartu;

39.2. akvakultūras dzīvniekus ne ilgāk kā vienu mēnesi tur nosūtīšanas centrā vai attīrīšanas centrā, kas aprīkots ar notekūdeņu attīrīšanas sistēmu, kas spējīga dezaktivēt konkrētos patogēnus vai kuras notekūdeņi ir pakļauti citai apstrādei, kas līdz pieņemamam līmenim samazina iespējamību pārnest slimību uz dabiskajām ūdenstilpēm.

40. Savvaļas ūdensdzīvniekus, kuri ir uzņēmīgi pret kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām, ja tie ir noķerti Latvijas valsts teritorijā, zonā vai iecirknī, kas nav pasludināts par konkrētās infekcijas slimības neskartu, dienesta amatpersonas uzraudzībā ievieto karantīnā, līdz samazinās infekcijas slimības pārnešanas iespējamība. Pēc karantīnas laika beigām ūdensdzīvniekus izlaiž audzētavā vai divvāku molusku audzēšanas zonā, kura atrodas Latvijas valsts teritorijā, zonā vai iecirknī, kas ir pasludināts par attiecīgās infekcijas slimības neskartu.

41. Tradicionālā ekstensīvā lagūnu akvakultūras prakse atļauta bez šo noteikumu 40. punktā minētās ievietošanas karantīnā, ja veikts riska novērtējums un atzīts, ka iespējamība inficēties nav lielāka par tādu, kāda rastos, piemērojot šo noteikumu 40. punktu.

42. Dekoratīvos ūdensdzīvniekus atļauts piedāvāt tirgū, ja tie neapdraud ūdensdzīvnieku veselību attiecībā uz inficēšanos ar citām infekcijas slimībām, kas nav minētas šajos noteikumos, un netiek izplatītas šo noteikumu 1. pielikumā minētās infekcijas slimības.

V. Akvakultūras dzīvnieku un to produktu ievešana no valstīm, kas nav Eiropas Savienības dalībvalstis

43. Akvakultūras dzīvniekus un to produktus ieved Latvijā no valstīm, kas nav Eiropas Savienības dalībvalstis (turpmāk – trešās valstis), vai šādu valstu daļām, ja tās iekļautas Eiropas Komisijas sagatavotajā un publicētajā sarakstā.

44. Visiem akvakultūras dzīvnieku un to produktu sūtījumiem no trešajām valstīm vai to daļām ir pievienots veterinārais (veselības) sertifikāts, kurš apliecina, ka sūtījums atbilst:

44.1. šajos noteikumos noteiktajām prasībām;

44.2. prasībām, kas noteiktas citos normatīvajos aktos par sabiedrības un dzīvnieku veselību.

VI. Paziņošana par infekcijas slimībām un akvakultūras dzīvnieku un ūdensdzīvnieku infekcijas slimību kontroles pasākumi

45. Informāciju par akvakultūras dzīvnieku saslimšanu ar šo noteikumu 1. pielikumā minētajām infekcijas slimībām vai aizdomām par šo slimību esību (tai skaitā akvakultūras dzīvnieku mirstības pieaugumu) akvakultūras dzīvnieku īpašnieks vai turētājs, pārstrādes uzņēmuma īpašnieks, praktizējošs veterinārārsts, laboratorijas vadītāja pilnvarota persona vai jebkura cita persona, kurai ir kontakts ar akvakultūras vai ūdensdzīvniekiem (persona, kura akvakultūras dzīvniekus kopj vai pavada tos pārvadāšanas laikā), sniedz saskaņā ar normatīvajiem aktiem par ziņojamām, reģistrējamām un valsts uzraudzībā esošām dzīvnieku infekcijas slimībām un kārtību, kādā par tām sniedzama informācija dienestam.

46. Dienests 24 stundu laikā, kopš saņemta informācija par to, ka ir apstiprinājušās aizdomas par infekcijas slimību, informē Eiropas Komisiju, pārējās Eiropas Savienības dalībvalstis un Eiropas Brīvās tirdzniecības asociācijas dalībvalstis, norādot:

46.1. attiecīgo šo noteikumu 1. pielikuma I daļā minēto eksotisko infekcijas slimību;

46.2. attiecīgo šo noteikumu 1. pielikuma II daļā minēto neeksotisko infekcijas slimību, ja pirms tam Latvijas valsts teritorija, zona vai iecirknis ir bijis pasludināts par konkrētās infekcijas slimības neskartu teritoriju, zonu vai iecirkni.

47. Ja ir aizdomas par kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām Latvijas valsts teritorijā, zonā vai iecirknī, kurā akvakultūras dzīvnieku veselības stāvoklis attiecībā uz minēto slimību atbilst šo noteikumu 3. pielikumā noteiktajai I vai III kategorijai:

47.1. dienesta amatpersona ņem paraugus un nosūta tos uz references laboratoriju;

47.2. dienesta amatpersona līdz analīžu rezultātu saņemšanai audzētavu vai divvāku molusku audzēšanas zonu uzrauga un veic kontroles pasākumus, lai novērstu infekcijas slimības izplatīšanos citu ūdensdzīvnieku vai akvakultūras dzīvnieku vidū;

47.3. līdz analīžu rezultātu saņemšanai skartajā audzētavā vai divvāku molusku audzēšanas zonā aizliegts ievest vai izvest no tās akvakultūras dzīvniekus, izņemot gadījumu, ja dienesta amatpersona ir devusi rakstisku atļauju nosūtīt akvakultūras dzīvniekus uz atzītu pārstrādes uzņēmumu, kas nodarbojas ar akvakultūras dzīvnieku kaušanu, lai kontrolētu slimību izplatīšanos;

47.4. dienesta amatpersona veic epizootoloģisko izmeklēšanu saskaņā ar šo noteikumu 48. un 49. punktu.

48. Epizootoloģisko izmeklēšanu veic, ja laboratoriskajos izmeklējumos konstatēta saslimšana ar kādu no šo noteikumu 1. pielikumā minētajām:

48.1. eksotiskajām infekcijas slimībām Latvijas valsts teritorijā, zonā vai iecirknī;

48.2. neeksotiskajām infekcijas slimībām Latvijas valsts teritorijā, zonā vai iecirknī, kurā akvakultūras dzīvnieku veselības stāvoklis attiecībā uz konstatēto infekcijas slimību atbilst šo noteikumu 3. pielikumā noteiktajai I vai III kategorijai.

49. Epizootoloģisko izmeklēšanu veic, lai:

49.1. noteiktu iespējamo infekcijas slimības izcelsmes avotu un pārnēsātājus faktorus;

49.2. pārbaudītu, vai akvakultūras dzīvnieki ir atstājuši audzētavu vai divvāku molusku audzēšanas zonu attiecīgajā laikposmā pirms aizdomu paziņošanas par inficēšanos;

49.3. izpētītu, vai nav inficētas arī citas audzētavas vai divvāku molusku audzēšanas zonas.

50. Ja šo noteikumu 49. punktā minētajā epizootoloģiskajā izmeklēšanā konstatēts, ka infekcijas slimība var būt izplatījusies vienā vai vairākās audzētavās, divvāku molusku audzēšanas zonās vai atklātos ūdeņos, minētajās vietās veic šādus pasākumus:

50.1. dienesta amatpersona ņem paraugus un nosūta tos uz references laboratoriju;

50.2. līdz analīžu rezultātu saņemšanai dienesta amatpersona uzdod akvakultūras dzīvnieku īpašniekam vai turētājam veikt ierobežojošus pasākumus, lai novērstu infekcijas slimības izplatīšanos citu ūdensdzīvnieku vai akvakultūras dzīvnieku vidū, un kontrolē to izpildi;

50.3. līdz analīžu rezultātu saņemšanai skartajā audzētavā vai divvāku molusku audzēšanas zonā aizliegts ievest vai izvest no tās akvakultūras dzīvniekus, izņemot gadījumu, ja dienesta amatpersona ir devusi rakstisku atļauju nosūtīt akvakultūras dzīvniekus uz atzītu akvakultūras dzīvnieku pārstrādes uzņēmumu, kas nodarbojas ar akvakultūras dzīvnieku kaušanu, lai kontrolētu slimību izplatīšanos.

51. Ja infekcijas slimības skartā teritorija ir plašs ūdens sateces baseins vai piekrastes rajons, dienests šo noteikumu 50. punktā minētos pasākumus ierobežo līdz mazākai teritorijai, kura atrodas par inficēšanos aizdomās turētās audzētavas vai divvāku molusku audzēšanas zonas tuvumā un kura ir pietiekami liela, lai garantētu infekcijas slimības ierobežošanu.

52. Dienests triju darbdienu laikā no dienas, kad radušās aizdomas par akvakultūras dzīvnieku inficēšanos ar kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām, informē kompetentās iestādes, kuras veic dzīvnieku infekcijas slimību kontroles un uzraudzības funkcijas kaimiņos esošajās Eiropas Savienības dalībvalstīs un trešajās valstīs.

53. Dienests atceļ šo noteikumu 47.2., 47.3. un 47.4. apakšpunktā minētos ierobežojošos pasākumus, ja laboratoriskajos izmeklējumos netiek konstatēta saslimšana ar kādu no infekcijas slimībām.

VII. Kontroles un apkarošanas pasākumi pēc eksotisko infekcijas slimību konstatēšanas akvakultūras dzīvniekiem

54. Pēc tam kad konstatēta akvakultūras dzīvnieku inficēšanās ar eksotisku infekcijas slimību un references laboratorijā apstiprināta diagnoze:

54.1. dienests audzētavai vai divvāku molusku audzēšanas zonai nosaka šajā nodaļā minētos ierobežojumus un pasludina to par inficētu;

54.2. dienests ap inficēto audzētavu vai divvāku molusku audzēšanas zonu izveido buferzonu, kurā ir aizsardzības zona un uzraudzības zona (zonu lielumu nosaka atbilstoši infekcijas slimības izplatīšanās iespējām);

54.3. audzētavā vai divvāku molusku audzēšanas zonā pārtrauc krājumu atjaunošanu, bet buferzonā neieved akvakultūras dzīvniekus;

54.4. akvakultūras dzīvniekus nepārvieto buferzonas robežās un neizved no tās, izņemot gadījumu, ja dienesta amatpersona ir izsniegusi rakstisku atļauju šo dzīvnieku pārvadāšanai uz atzītu pārstrādes uzņēmumu, kas nodarbojas ar akvakultūras dzīvnieku kaušanu, lai kontrolētu slimību izplatīšanos;

54.5. audzētavā vai divvāku molusku audzēšanas zonā veic pasākumus, kas nodrošina infekcijas slimības ierobežošanu.

55. Akvakultūras dzīvniekus, kuri sasnieguši komerciālus izmērus un kuriem nav infekcijas slimības klīnisko simptomu, dienesta amatpersonas uzraudzībā ievāc, lai lietotu pārtikā vai veiktu to turpmāku pārstrādi.

56. Akvakultūras dzīvnieku ievākšanu, ievešanu nosūtīšanas centros vai attīrīšanas centros, dzīvnieku turpmāku pārstrādi vai citas darbības, kas ietilpst akvakultūras dzīvnieku sagatavošanas procesā pirms to nonākšanas pārtikas apritē, veic apstākļos, kas neļauj izplatīties infekcijas slimības ierosinātājam.

57. Nosūtīšanas centrus, attīrīšanas centrus un līdzīgus uzņēmumus aprīko ar notekūdeņu attīrīšanas sistēmu, kas spēj dezaktivēt infekcijas slimības ierosinātāju, kurš izraisījis infekcijas slimību, vai veic notekūdeņu apstrādi, kas līdz pieņemamam līmenim samazina iespējamību pārnest infekcijas slimību uz dabiskajiem ūdeņiem.

58. Akvakultūras dzīvnieku turpmāku pārstrādi veic atzītā pārstrādes uzņēmumā.

59. Mirušās zivis un mirušos vēžveidīgos, kā arī dzīvās zivis un dzīvos vēžveidīgos, kuriem ir infekcijas slimības klīniskie simptomi, atbilstoši šo noteikumu 82. punktā minētajā rīcības plānā noteiktajai kārtībai nekavējoties savāc, pārstrādā, izmanto un likvidē dienesta amatpersonas uzraudzībā saskaņā ar Eiropas Parlamenta un Padomes 2009. gada 21. oktobra Regulu (EK) Nr. 1069/2009, ar ko nosaka veselības aizsardzības noteikumus attiecībā uz dzīvnieku izcelsmes blakusproduktiem un atvasinātajiem produktiem, kuri nav paredzēti cilvēku patēriņam, un ar ko atceļ Regulu (EK) Nr. 1774/2002 (turpmāk – regula (EK) Nr. 1069/2009).

60. Akvakultūras dzīvniekus, kuri nav sasnieguši komerciālus izmērus un kuriem nav infekcijas slimības klīnisko simptomu, savāc, pārstrādā un izmanto dienesta amatpersonas uzraudzībā saskaņā ar regulu (EK) Nr. 1069/2009 kā trešās kategorijas dzīvnieku izcelsmes blakusproduktus, kas nav paredzēti cilvēku patēriņam, kā arī saskaņā ar šo noteikumu 82. punktā minētajā rīcības plānā noteikto kārtību, ņemot vērā ražošanas veidu un infekcijas slimības turpmākās izplatīšanās risku, ko šādi dzīvnieki var palielināt.

61. Pēc akvakultūras dzīvnieku aizvākšanas no audzētavas vai divvāku molusku audzēšanas zonas un pēc inficētās teritorijas tīrīšanas un dezinfekcijas audzētavu vai divvāku molusku audzēšanas zonu atstāj neizmantotu uz laikposmu, kas ir pietiekams, lai iznīcinātu infekcijas slimības ierosinātāju. Dienests, pamatojoties uz riska novērtējumu un infekcijas slimības atkārtošanās iespējamību, triju darbdienu laikā, skaitot no dienas, kad ir veikta inficētās teritorijas tīrīšana un dezinfekcija, pieņem lēmumu par audzētavas vai divvāku molusku audzēšanas zonas neizmantošanas ilgumu.

62. Dienests nosaka nepieciešamos pasākumus, kas jāveic audzētavā vai divvāku molusku audzēšanas zonā, lai novērstu infekcijas slimību izplatīšanos citu ūdensdzīvnieku vidū. Minētie pasākumi ietver akvakultūras dzīvnieku pārvietošanas ierobežojumus, karantīnas noteikšanu pirms akvakultūras dzīvnieku izvešanas vai ievešanas, notekūdeņu attīrīšanu un citus līdzvērtīgus pasākumus, kas nodrošina infekcijas slimības ierosinātāja ierobežošanu inficētajā teritorijā.

63. Šajā nodaļā minētos pasākumus dienests turpina piemērot:

63.1. līdz šajā nodaļā minēto infekcijas slimības apkarošanas pasākumu pabeigšanai;

63.2. līdz brīdim, kamēr buferzonā esošajā akvakultūras nozares uzņēmumā konkrētajai infekcijas slimībai atbilstošā kārtībā ņemto paraugu laboratoriskajos izmeklējumos netiek konstatēti infekcijas slimības ierosinātāji.

VIII. Kontroles un apkarošanas pasākumi pēc neeksotisko infekcijas slimību konstatēšanas akvakultūras dzīvniekiem

64. Ja Latvijas valsts teritorijā, zonā vai iecirknī, kas ir pasludināts par šo noteikumu 1. pielikuma II daļā minēto neeksotisko infekcijas slimību neskartu teritoriju, zonu vai iecirkni, apstiprinās infekcijas slimības uzliesmojums, dienests veic vienu no šādiem pasākumiem:

64.1. izpilda šo noteikumu VII nodaļā minētās prasības, lai iegūtu infekcijas slimības neskartas teritorijas statusu. Ja piemēro šo noteikumu VII nodaļā minētās prasības, klīniski veselus akvakultūras dzīvniekus atļauts izaudzēt līdz komerciāliem izmēriem, lai tos nokautu un lietotu pārtikā, vai tos pārvietot uz citu inficētu zonu vai iecirkni. Pārvietošanas laikā veic pasākumus, lai novērstu infekcijas slimības tālāku izplatīšanos;

64.2. izstrādā uzraudzības un apkarošanas programmu, iesniedz to apstiprināšanai Eiropas Komisijā un īsteno programmā noteiktos pasākumus.

65. Ja Latvijas valsts teritorijā, zonā vai iecirknī, kas ir pasludināts par šo noteikumu 1. pielikuma II daļā minēto neeksotisko infekcijas slimību skartu teritoriju, zonu vai iecirkni, apstiprinās infekcijas slimības uzliesmojums un dienests pēc epizootoloģiskās situācijas izvērtēšanas nolemj, ka neeksotisko infekcijas slimību neskartas teritorijas, zonas vai iecirkņa statuss nav atgūstams:

65.1. dienests audzētavu vai divvāku molusku audzēšanas zonu pasludina par inficētu;

65.2. ap inficēto audzētavu vai divvāku molusku audzēšanas zonu dienests nosaka buferzonu, kas sastāv no aizsardzības zonas un uzraudzības zonas;

65.3. dienests kontrolē akvakultūras dzīvnieku kustību no buferzonas. Buferzonas teritorijā akvakultūras dzīvniekus atļauts ievest audzētavā vai divvāku molusku audzēšanas zonā šo noteikumu 3. pielikumā noteiktajā kārtībā;

65.4. buferzonas teritorijā atļauts ievākt un nokaut akvakultūras dzīvniekus lietošanai pārtikā, ja tie ir sasnieguši komerciālu izmēru, tiem nav infekcijas slimības klīnisko simptomu un attiecīgās darbības tiek veiktas dienesta amatpersonas uzraudzībā;

65.5. mirušās zivis un vēžveidīgos aizvāc un likvidē dienesta amatpersonas uzraudzībā saskaņā ar regulu (EK) Nr. 1069/2009, ņemot vērā ražošanas veidu, kā arī infekcijas slimības turpmākās izplatīšanās risku, ko šādi dzīvnieki var palielināt.

IX. Kontroles un apkarošanas pasākumi pēc eksotisko un neeksotisko infekcijas slimību konstatēšanas savvaļas ūdensdzīvniekiem

66. Ja tiek konstatēta savvaļas ūdensdzīvnieku inficēšanās vai ir aizdomas par to inficēšanos ar kādu no šo noteikumu 1. pielikumā minētajām eksotiskajām vai neeksotiskajām infekcijas slimībām, dienests organizē šo noteikumu 65. punktā minētos pasākumus un nosaka ierobežojumus, lai samazinātu un novērstu infekcijas slimības turpmāku izplatīšanos audzētavā vai divvāku molusku audzēšanas zonā.

67. Dienests piemērojamos pasākumus savvaļas ūdensdzīvnieku infekcijas slimības apkarošanai izstrādā, ņemot vērā epizootoloģisko situāciju. Dienests aizliedz ūdensdzīvnieku nozveju un ievietošanu akvakultūras audzētavās vai divvāku molusku audzēšanas zonās, nosaka akvakultūras dzīvnieku pārvietošanas ierobežojumus audzētavās vai divvāku molusku audzēšanas zonās, kuras atrodas inficētajā teritorijā.

68. Dienests informē pārējās Eiropas Savienības dalībvalstis un Eiropas Komisiju par šo noteikumu 66. punktā minētajiem pasākumiem.

X. Uzraudzības un kontroles pasākumi jaunu infekcijas slimību uzliesmojuma gadījumā

69. Dienests veic akvakultūras dzīvnieku uzraudzību. Ja tiek konstatēta jauna infekcijas slimība, dienests izstrādā un iesniedz Zemkopības ministrijā priekšlikumus par pasākumiem jaunās infekcijas slimības izplatīšanās novēršanai akvakultūras dzīvnieku un ūdensdzīvnieku vidū. Zemkopības ministrija izvērtē dienesta izstrādātos priekšlikumus, sagatavo attiecīgu noteikumu projektu un iesniedz apstiprināšanai Ministru kabinetā.

70. Ja akvakultūras dzīvniekiem parādījusies jauna infekcijas slimība, dienests 24 stundu laikā no brīža, kad konstatēts fakts par akvakultūras dzīvnieku inficēšanos ar jaunu infekcijas slimību, par to informē citas Eiropas Savienības dalībvalstis, Eiropas Komisiju un Eiropas Brīvās tirdzniecības asociācijas dalībvalstis, ja konstatētie fakti ir epizootoloģiski nozīmīgi citai valstij (Latvijai ir tirdzniecības attiecības ar konkrēto valsti, jaunās infekcijas slimības izplatības faktori nav noskaidroti, valsts ir Latvijas kaimiņvalsts, infekcijas slimības ierobežošanai un kontrolei nepieciešama sadarbība ar citām valstīm).

71. Ja jaunā infekcijas slimība apdraud Latvijas valsts teritorijā esošo akvakultūras dzīvnieku un ūdensdzīvnieku veselības stāvokli, dienests veic šo noteikumu VII un VIII nodaļā minētos pasākumus, kā arī pasākumus, lai novērstu jaunās infekcijas slimības ievešanu un veiktu tās kontroli.

72. Dienests triju darbdienu laikā no dienas, kad ir ieviesti šo noteikumu 71. punktā minētie pasākumi, paziņo par to Eiropas Komisijai, kā arī informē par pasākumiem, kas var ietekmēt tirdzniecību starp Eiropas Savienības dalībvalstīm.

XI. Uzraudzības un apkarošanas programmu izstrāde un darbība

73. Ja nav zināms, ka Latvijas valsts teritorijā ir izplatīta kāda no šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām, un ja Latvijas valsts teritorija vai kāda tās daļa nav pasludināta par konkrētās infekcijas slimības neskartu (III kategorija saskaņā ar šo noteikumu 3. pielikumu), dienests izstrādā un iesniedz apstiprināšanai Eiropas Komisijā uzraudzības programmu, lai iegūtu infekcijas slimības neskartas teritorijas statusu.

74. Paraugu ņemšanas kārtību un infekcijas slimību diagnostiku šo noteikumu 73. punktā minētās uzraudzības programmas īstenošanai dienests saskaņo ar Eiropas Komisiju.

75. Ja šo noteikumu 73. punktā minētā uzraudzības programma tiek attiecināta uz atsevišķiem iecirkņiem un zonām, kas aptver mazāk par 75 % no Latvijas valsts teritorijas, un zonu vai iecirkni veido ūdens sateces baseins, kas nav kopīgs ar citu valsti, šādu uzraudzības programmu apstiprina, groza vai atceļ saskaņā ar šo noteikumu 93. punktu.

76. Ja ir zināms, ka Latvijas valsts teritorijā ir izplatīta kāda no šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām (IV kategorija saskaņā ar šo noteikumu 3. pielikumu), dienests izstrādā un iesniedz apstiprināšanai Eiropas Komisijā apkarošanas programmu.

77. Dienests informē pārējās Eiropas Savienības dalībvalstis un Eiropas Komisiju par uzraudzības un apkarošanas programmām, kas ir apstiprinātas saskaņā ar šo noteikumu 73. un 76. punktu un ko īsteno Latvijas valsts teritorijā.

78. Teritorijās, kurās īsteno šo noteikumu 73. vai 76. punktā minētās uzraudzības vai apkarošanas programmas, nodrošina šo noteikumu 26., 27., 28., 29., 30., 31., 32., 33., 34., 35., 36., 37., 38., 39., 40., 41., 42., 47., 48., 49., 50., 51., 52., 53. un 64. punktā minēto prasību izpildi.

79. Uzraudzības vai apkarošanas programmā:

79.1. apraksta infekcijas slimības epizootoloģisko situāciju pirms programmas uzsākšanas;

79.2. aprēķina programmai nepieciešamos naudas līdzekļus (kārtējā gadā piešķirtie valsts budžeta līdzekļi un Eiropas Zivju fonda līdzekļi) un analizē gaidāmos ieguvumus;

79.3. nosaka programmas darbības ilgumu un mērķus, kas jāsasniedz līdz programmas darbības beigām;

79.4. apraksta programmas īstenošanas ģeogrāfisko un administratīvo teritoriju un nosaka tās robežas.

80. Uzraudzības vai apkarošanas programmu:

80.1. īsteno, līdz ir izpildītas šo noteikumu XIV nodaļā noteiktās prasības un Latvijas valsts teritorija, zona vai iecirknis tiek pasludināts par infekcijas slimības neskartu;

80.2. dienests vai Eiropas Komisija atceļ, ja tā nav mērķtiecīga.

81. Ja uzraudzības vai apkarošanas programmu atceļ saskaņā ar šo noteikumu 80.2. apakšpunktu, veic šo noteikumu 65. punktā minētos pasākumus.

XII. Rīcības plāns, tā darbība un vakcinācijas kārtība

82. Dienests izstrādā rīcības plānu šo noteikumu 1. pielikuma pirmajā daļā minēto eksotisko infekcijas slimību un jaunu infekcijas slimību uzliesmojuma apkarošanai. Rīcības plānā:

82.1. paredz darbības, kas nodrošina rīcības plāna ieviešanu, veicot ātru un veiksmīgu infekcijas slimības apkarošanas kampaņu;

82.2. nodrošina koordināciju un saskaņotību ar kaimiņos esošajām Eiropas Savienības dalībvalstīm un trešajām valstīm;

82.3. paredz darbības, kas nodrošina šādu normatīvajos aktos noteikto prasību izpildi:

82.3.1. to dzīvnieku izcelsmes blakusproduktu savākšana un iznīcināšana, kuri nav paredzēti cilvēku patēriņam;

82.3.2. dzīvnieku izcelsmes pārtikas produktu un dzīvnieku barības iegūšana un izplatīšana;

82.3.3. tirdzniecība ar dzīviem dzīvniekiem, dzīvnieku izcelsmes pārtikas produktiem un dzīvnieku barību;

82.4. norāda detalizētu vadības shēmu, iekļaujot infekcijas slimības uzliesmojuma novēršanā iesaistāmās valsts un pašvaldību iestādes, lai nodrošinātu operatīvu lēmumu pieņemšanu un pieņemto lēmumu īstenošanu;

82.5. paredz pasākumus, lai nodrošinātu nepieciešamo resursu pieejamību, tai skaitā finanšu resursu (Zemkopības ministrijai kārtējam gadam piešķirtie valsts budžeta līdzekļi, līdzekļi neparedzētiem gadījumiem, Eiropas Savienības budžeta līdzekļi infekcijas slimības kontroles un apkarošanas pasākumos radušos zaudējumu atmaksai Eiropas Savienības dalībvalstīm), efektīvai infekcijas slimības apkarošanas kampaņai (piemēram, nodrošinājums ar laboratorijas personālu, ekipējumu un infrastruktūru);

82.6. nosaka vadlīnijas, kurās norāda praktisko darbību veikšanas kārtību visos infekcijas slimības apkarošanas posmos, kā arī dezinfekcijas kārtību;

82.7. norāda detalizētu informāciju par kontroles pasākumos iesaistīto personu nepieciešamajām prasmēm un viņu pienākumiem, kā arī nepieciešamos individuālos aizsardzības līdzekļus;

82.8. izstrādā vakcinācijas plānu un kārtību;

82.9. paredz apkarošanas pasākumos iesaistīto personu izglītošanas programmu par infekcijas slimības klīniskajiem simptomiem, epizootoloģisko uzraudzību, kontroli un infekcijas slimības apkarošanu, kā arī plāno mācību trauksmes ar reāliem notikumiem, lai attīstītu komunikācijas iemaņas un veicinātu valsts iestāžu amatpersonu, audzētāju un veterinārārstu izpratni par infekcijas slimības apkarošanu;

82.10. norāda diagnostikas laboratorijas, kuras aprīkotas akvakultūras dzīvnieku līķu ihtiopatoloģiskai, seroloģiskai, virusoloģiskai vai cita veida izmeklēšanai. Paredz rīcību ātrai paraugu transportēšanai uz laboratoriju, kā arī laboratorijas analīžu veikšanas iespējas un pieejamos resursus rīcībai infekcijas slimības uzliesmojuma gadījumā;

82.11. izstrādā rīcību gadījumiem, ja īsā laikā nepieciešams kontrolēt lielu skaitu uzliesmojumu;

82.12. nosaka darbības, lai infekcijas slimības uzliesmojuma gadījumā, neapdraudot cilvēku veselību un izmantojot procedūras vai metodes, kas novērš kaitējumu videi, minimāli apdraud augsni, gaisu, virszemes un pazemes ūdeņus, augus un dzīvniekus, rada minimālus trokšņa traucējumus vai smaku, kā arī minimālu kaitīgo ietekmi uz lauku ainavu vai īpašiem apskates objektiem, nodrošinātu akvakultūras dzīvnieku līķu un to blakusproduktu masveida apglabāšanu, kas nav paredzēti cilvēku patēriņam;

82.13. nosaka uzņēmumus, kur paredzēts iznīcināt dzīvnieku izcelsmes blakusproduktus, kas nav paredzēti cilvēku patēriņam.

83. Dienests rīcības plānu iesniedz apstiprināšanai Eiropas Komisijā un pēc pozitīva saskaņojuma saņemšanas publicē oficiālajā izdevumā "Latvijas Vēstnesis". Rīcības plānu atjauno reizi piecos gados un iesniedz apstiprināšanai Eiropas Komisijā.

84. Vakcinācija pret šo noteikumu 1. pielikuma I daļā minētajām eksotiskajām infekcijas slimībām ir aizliegta, izņemot gadījumu, ja to veic pēc saskaņošanas ar Eiropas Komisiju. Vakcinācijas kampaņas uzsākšanu dienests saskaņo ar Eiropas Komisiju.

85. Vakcinācija pret šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām ir aizliegta visās teritoriju daļās, kas ir pasludinātas par infekcijas slimības neskartām, kā arī teritorijās, kurās tiek īstenota šo noteikumu 73. punktā minētā uzraudzības programma.

86. Vakcinācija pret šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām ir atļauta tajās teritorijās vai to daļās, kas nav pasludinātas par konkrētās infekcijas slimības neskartām vai kurās vakcinācija tiek veikta kā daļa no infekcijas slimības apkarošanas programmas. Apkarošanas programma ir apstiprināta atbilstoši šo noteikumu 76. punktam.

87. Vakcīnas izvēlas saskaņā ar normatīvajiem aktiem par veterināro zāļu reģistrēšanas kārtību un Eiropas Parlamenta un Padomes 2004. gada 31. marta Regulu (EK) Nr. 726/2004, ar ko nosaka cilvēkiem paredzēto un veterināro zāļu reģistrēšanas un uzraudzības Kopienas procedūras un izveido Eiropas Zāļu aģentūru.

88. Šo noteikumu 85. un 86. punktā minētās prasības neattiecas uz zinātniskiem pētījumiem, kuru mērķis ir vakcīnu izstrāde un pārbaude kontrolētos apstākļos. Pētījumu laikā veic pasākumus, lai pasargātu pārējos ūdensdzīvniekus no jebkādas negatīvas ietekmes, ko rada pētījumu laikā veiktā vakcinācija.

XIII. Kārtība, kādā Latvijas valsts teritoriju pasludina par neeksotisko infekcijas slimību neskartu

89. Dienests iesniedz Eiropas Komisijai nepieciešamo informāciju, lai pasludinātu Latvijas valsts teritoriju par šo noteikumu 1. pielikuma II daļā minēto neeksotisko infekcijas slimību neskartu, ja:

89.1. Latvijas valsts teritorijā nav sastopama neviena akvakultūras vai ūdensdzīvnieku suga, kas ir uzņēmīga pret konkrēto infekcijas slimības ierosinātāju;

89.2. ir zināms, ka infekcijas slimības ierosinātājs nespēj izdzīvot Latvijas valsts teritorijas ūdeņos;

89.3. Latvijas valsts teritorijā tiek izpildīti šo noteikumu 102., 103. un 104. punktā minētie nosacījumi;

89.4. kaimiņos esošo Eiropas Savienības dalībvalstu kompetentās iestādes ir noteikušas buferzonu, ja šo valstu teritorija ir konkrētas akvakultūras dzīvnieku infekcijas slimības skarta. Buferzonu norobežošana pasargā Latvijas valsts teritorijā esošos akvakultūras dzīvniekus no inficēšanās ar infekcijas slimības ierosinātāju pasīvās pārnešanas ceļā.

90. Dienests izveido buferzonu Latvijas valsts teritorijā, ja Latvijas valsts teritorijā vai ūdens sateces baseinā, kas ir kopīgs ar kaimiņos esošajām Eiropas Savienības dalībvalstīm, ir konstatēta kāda no šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām un teritorija nav pasludināta par konkrētās infekcijas slimības neskartu. Buferzonas norobežošana pasargā infekcijas slimības neskartās valsts akvakultūras dzīvniekus no inficēšanās ar infekcijas slimības ierosinātāju pasīvās pārnešanas ceļā.

91. Buferzonas lielumu, tās uzraudzības un paraugu ņemšanas kārtību buferzonā, kā arī diagnostikas metodes, ko izmanto, lai iegūtu infekcijas slimības neskartas teritorijas statusu, dienests saskaņo ar Eiropas Komisiju.

92. Dienests pasludina zonu vai iecirkni par šo noteikumu 1. pielikuma II daļā minēto neeksotisko infekcijas slimību neskartu, ja zona vai iecirknis atbilst vienai no šādām prasībām:

92.1. zonas vai iecirkņa ūdeņos nav sastopama neviena no akvakultūras dzīvnieku vai ūdensdzīvnieku sugām, kas ir uzņēmīga pret konkrēto infekcijas slimības ierosinātāju;

92.2. ir zināms, ka patogēns nespēj izdzīvot zonas vai iecirkņa ūdeņos;

92.3. zona vai iecirknis atbilst šo noteikumu 105., 106., 107., 108., 109., 110., 111., 112., 113., 114., 115., 116., 117., 118., 119., 120., 121. un 122. punktā minētajiem nosacījumiem.

93. Dienests Eiropas Komisijai nosūta deklarāciju par zonas vai iecirkņa pasludināšanu par neeksotiskas infekcijas slimības neskartu. Deklarācijai pievieno attiecīgu informāciju un dokumentus un elektroniski nosūta arī pārējo Eiropas Savienības dalībvalstu kompetentajām iestādēm. Deklarāciju izskata un pieņem Pastāvīgās komitejas Dzīvnieku veselības un labturības, kontroles un importa nosacījumu sekcijā.

94. Ja zona vai iecirknis, kas pretendē uz neeksotiskas infekcijas slimības neskartas zonas vai iecirkņa statusu, veido vairāk nekā 75 % no Latvijas valsts teritorijas vai gadījumā, ja zonu vai iecirkni veido ūdens sateces baseins, kas ir kopīgs ar citu Eiropas Savienības dalībvalsti, šādu zonu vai iecirkni par infekcijas slimības neskartu pasludina Eiropas Komisija.

95. Lai zonu vai iecirkni pasludinātu par neeksotiskas infekcijas slimības neskartu, dienests ar Eiropas Komisiju saskaņo kārtību, kādā tas veic uzraudzību un paraugu ņemšanu.

96. Dienests izveido, uztur un atjauno to zonu un iecirkņu sarakstu, kuri ir pasludināti par neeksotiskas infekcijas slimības neskartiem saskaņā ar šo noteikumu 92. un 93. punktu. Dienests nodrošina minētās informācijas publisku pieejamību.

97. Ja Latvijas valsts teritorija saskaņā ar šo noteikumu 88. punktu ir pasludināta par neeksotiskas infekcijas slimības neskartu, dienests var pārtraukt mērķtiecīgu uzraudzību. Latvijas valsts teritorijai saglabājas neeksotiskas infekcijas slimības neskartas teritorijas statuss, ja tiek izpildīti šo noteikumu 89. punktā minētie nosacījumi.

98. Ja Latvijas valsts teritorijā ir zonas un iecirkņi, kuros nav sastopama neviena no šo noteikumu 1. pielikuma II daļā minētajām neeksotiskajām infekcijas slimībām, bet zona vai iecirknis nav pasludināts par konkrētās infekcijas slimības neskartu, kā arī situācijā, ja nepastāv konkrētās infekcijas slimības klīnisko attīstību veicinoši apstākļi, dienests mērķtiecīgu uzraudzību veic saskaņā ar šo noteikumu 91. vai 95. punktu.

99. Ja dienests konstatē, ka ir pārkāpts kāds no nosacījumiem, kas jāpilda, lai saglabātu neeksotiskas infekcijas slimības neskartas teritorijas, zonas vai iecirkņa statusu, dienests:

99.1. aptur uzņēmīgo akvakultūras dzīvnieku sugu un infekcijas slimību pārnēsātāju sugu tirdzniecību ar citām Eiropas Savienības dalībvalstīm, zonām vai iecirkņiem, kuriem ir labāks veselības stāvoklis attiecībā uz konkrēto infekcijas slimību, un rīkojas šo noteikumu 3. pielikumā noteiktajā kārtībā;

99.2. piemēro šo noteikumu 47., 48., 49., 50., 51., 52., 53., 64. un 65. punktā minētās prasības.

100. Ja epizootoloģisko izmeklējumu laikā, kurus veic, lai piemērotu šo noteikumu 99. punktā minētos nosacījumus, dienests konstatē, ka nav pārkāpts neviens nosacījums, kas jāpilda, lai saglabātu infekcijas slimības neskartas dalībvalsts teritorijas, zonas vai iecirkņa statusu, Latvijas valsts teritorijai, attiecīgajai zonai vai iecirknim atjauno infekcijas slimības neskartas teritorijas, zonas vai iecirkņa statusu.

101. Ja epizootoloģisko izmeklējumu laikā, kurus veic, lai piemērotu šo noteikumu 99. punktā minētos nosacījumus, dienests konstatē, ka ir pārkāpts kāds no nosacījumiem, kas jāpilda, lai saglabātu infekcijas slimības neskartas dalībvalsts teritorijas, zonas vai iecirkņa statusu, šo statusu atceļ. Pirms infekcijas slimības neskartas teritorijas statusa atjaunošanas izpilda šo noteikumu XV nodaļā minētās prasības.

XIV. Bioloģiskās drošības pasākumi un prasības Latvijas valsts teritorijai, zonai un iecirknim, lai to pasludinātu par infekcijas slimības neskartu

102. Bioloģiskās drošības pasākumi ir šādi:

102.1. akvakultūras dzīvnieku īpašnieks vai turētājs informē dienesta teritoriālo struktūrvienību par infekcijas slimības konstatēšanu vai aizdomām par tās esību akvakultūras dzīvnieku uzturēšanās vietā (audzētavā vai molusku audzēšanas zonā);

102.2. ir ieviesta infekcijas slimības agrīnās konstatēšanas sistēma, kas ļauj dienestam efektīvi veikt infekcijas slimības izmeklēšanu un nodrošina:

102.2.1. ātru to infekcijas slimības klīnisko pazīmju atpazīšanu, kas rada aizdomas par infekcijas slimību, kā arī nodrošina ātru jaunu infekcijas slimību konstatēšanu vai neizskaidrojamas akvakultūras dzīvnieku mirstības izmeklēšanu audzētavās, divvāku molusku audzēšanas zonās un savvaļas ūdensdzīvnieku populācijā;

102.2.2. ātru ziņošanu dienestam, lai pēc iespējas ātrāk sāktu diagnostisko izmeklēšanu.

103. Šo noteikumu 102.2. apakšpunktā minētā infekcijas slimības agrīnā konstatēšanas sistēma nodrošina, ka:

103.1. akvakultūras nozares uzņēmumu vai atzīto akvakultūras dzīvnieku pārstrādes uzņēmumu darbinieku izpratne par infekcijas slimībām, to klīniskajām pazīmēm vai aizdomām par akvakultūras dzīvnieku saslimšanu ir pietiekama;

103.2. veterinārārsti un ūdensdzīvnieku veselības eksperti ir apmācīti konstatēt neparastus infekcijas slimību gadījumus, spēj atpazīt aizdomīgus infekcijas slimības gadījumus un ziņo par tiem dienesta teritoriālajai struktūrvienībai;

103.3. dienestam ir pieejama atbilstoši aprīkota laboratorija, lai diagnosticētu šo noteikumu 1. pielikumā minētās akvakultūras dzīvnieku infekcijas slimības, kā arī jaunas, šajos noteikumos neminētas infekcijas slimības.

104. Latvijas valsts teritoriju pasludina par infekcijas slimības neskartu:

104.1. pamatojoties uz mērķtiecīgu uzraudzību, kā arī ja:

104.1.1. pēdējo 10 gadu laikā pirms infekcijas slimības neskartas Latvijas valsts teritorijas statusa piešķiršanas nav bijis klīnisks infekcijas slimības uzliesmojums;

104.1.2. Latvijas valsts teritorijas inficēšanās statuss nebija zināms;

104.2. ja saskaņā ar šo noteikumu 102. punktu tiek veikti bioloģiskās drošības pasākumi;

104.3. ja saskaņā ar šo noteikumu 91. punktu ne mazāk kā divus gadus tiek veikta mērķtiecīga uzraudzība un šajā laikposmā audzētavā vai divvāku molusku audzēšanas zonā nav konstatēti infekcijas slimības ierosinātāji. Ja Latvijas valsts teritorijas daļā audzētavu vai divvāku molusku audzēšanas zonu mērķtiecīga uzraudzība nesniedz pietiekami daudz epizootoloģisku datu, mērķtiecīgu uzraudzību attiecina arī uz savvaļā esošajām ūdensdzīvnieku populācijām, ja tajās atrod vienu vai vairākas uzņēmīgu dzīvnieku sugas.

105. Dienests nosaka zonu robežas un iezīmē tās kartē, pamatojoties uz vienu no šādiem kritērijiem:

105.1. zona ir viss ūdens sateces baseins no avota līdz ietekai;

105.2. zona ir ūdens sateces baseina daļa no avota līdz dabiskai vai mākslīgai barjerai, kas novērš savvaļas ūdensdzīvnieku migrāciju uz augšu no zemākiem ūdens sateces baseina posmiem;

105.3. zona ir vairāki ūdens sateces baseini un ietekas, ja tās ir epizootoloģiski saistītas ar ūdens sateces baseinu.

106. Dienestam nav atļauts pasludināt zonu par infekcijas slimības neskartu, ja tā iesniedzas kaimiņos esošās Eiropas Savienības dalībvalsts teritorijā, izņemot gadījumu, ja visā zonas teritorijā tiek pildīti šo noteikumu 107., 108. un 109. punktā minētie nosacījumi un abas Eiropas Savienības dalībvalstis lūdz Eiropas Komisijai reģistrēt kā infekcijas slimības neskartu to zonas daļu, kura atrodas katras Eiropas Savienības dalībvalsts teritorijā.

107. Infekcijas slimības neskartas zonas statusu iegūst, ja ir izpildītas šo noteikumu 104. punktā minētās prasības.

108. Zonu, kurā pēdējais zināmais klīniskās infekcijas slimības uzliesmojums noticis vairāk nekā 10 gadus pirms infekcijas slimības neskartas zonas statusa piešķiršanas vai kuras inficēšanās stāvoklis pirms mērķtiecīgas uzraudzības nebija zināms, uzskata par infekcijas slimības neskartu, un dienests tajā organizē pasākumus, kas nodrošina šo noteikumu 104. punktā minēto prasību izpildi.

109. Dienests zonā izveido buferzonu, kurā īsteno uzraudzības programmu. Buferzonu norobežo, lai kavētu infekcijas slimības ierosinātāju pasīvu ievešanu slimības neskartajā zonā.

110. Dienests nosaka iecirkņa robežas un iezīmē tās kartē.

111. Iecirkni, kurā ir pret infekcijas slimību uzņēmīgas sugas, bet kurā pēdējo 10 gadu laikā pirms infekcijas slimības neskarta iecirkņa statusa piešķiršanas nav konstatēts infekcijas slimības uzliesmojums, neraugoties uz apstākļiem, kas veicina infekcijas slimības klīnisko attīstību, uzskata par infekcijas slimības neskartu, ja iecirknis atbilst šādām prasībām:

111.1. ne mazāk kā pēdējos 10 gadus tiek veikti bioloģiskās drošības pasākumi saskaņā ar šo noteikumu 101. punktu;

111.2. nav ziņu par konkrētās infekcijas slimības sastopamību savvaļas ūdensdzīvnieku populācijā;

111.3. efektīvi tiek īstenoti tirdzniecības un importa nosacījumi, lai novērstu infekcijas slimības ievešanu Latvijas valsts teritorijā.

112. Infekcijas slimības neskarta iecirkņa statusu iegūst, ja ir izpildītas šo noteikumu 104. punktā minētās prasības.

113. Iecirkni, kurā pēdējo 10 gadu laikā pirms infekcijas slimības neskarta iecirkņa statusa piešķiršanas nav konstatēts klīniskās infekcijas slimības uzliesmojums vai kura apkārtnē ir iecirknis vai ūdeņi, kuru inficēšanās stāvoklis pirms mērķtiecīgas uzraudzības sākšanas nav bijis zināms, uzskata par infekcijas slimības neskartu, un dienests tajā organizē pasākumus, lai nodrošinātu šo noteikumu 104. punktā minēto nosacījumu izpildi.

114. Iecirknī, kurā īsteno uzraudzības programmu, katrai audzētavai vai divvāku molusku audzēšanas zonai:

114.1. dienests norobežo buferzonu;

114.2. veic dienesta amatpersonas noteiktus pasākumus, lai nepieļautu infekcijas slimības iekļūšanu un izplatīšanos.

115. Iecirknī, ko veido viena vai vairākas audzētavas, kurās akvakultūras dzīvnieku veselības stāvoklis attiecībā uz konkrētu infekcijas slimību nav atkarīgs no veselības stāvokļa attiecībā uz šo slimību apkārtējos ūdeņos, ir:

115.1. individuāla audzētava, ko uzskata par vienu epizootoloģisku vienību, jo to neietekmē apkārtējo ūdensdzīvnieku veselības stāvoklis;

115.2. vairākas audzētavas, ja tās iekļautas kopējā bioloģiskās drošības sistēmā un katra audzētava iecirknī atbilst šo noteikumu 115.1. apakšpunktā un 116., 117., 118., 119. un 120. punktā minētajām prasībām, bet plašās akvakultūras dzīvnieku kustības dēļ starp audzētavām to uzskata par vienu epizootoloģisku vienību.

116. Iecirkni apgādā ar ūdeni:

116.1. izmantojot ūdens piegādes ierīces, kas dezaktivē konkrēto infekcijas slimības ierosinātāju, samazinot infekcijas slimības izplatības iespējamību līdz pieņemamam līmenim;

116.2. tieši no akas, urbuma vai avota. Ja šāda ūdens apgāde izveidota ārpus audzētavas teritorijas, ūdeni piegādā tieši uz audzētavu pa cauruli.

117. Iecirknī ir dabiskas vai mākslīgas barjeras, kas neļauj apkārtējo ūdenstilpju ūdensdzīvniekiem nokļūt kādā no iecirkņa audzētavām.

118. Iecirkni aizsargā no applūšanas un apkārtējo ūdenstilpju ūdeņu ieplūšanas.

119. Iecirknī piemēro šo noteikumu 104. punktā minētās prasības.

120. Iecirknī veic pasākumus, lai nepieļautu infekcijas slimības pārnēsātāju iekļūšanu (kontrolē ūdens ņemšanas vietas, iecirknī ielaiž tikai klīniski veselus un karantīnā turētus akvakultūras dzīvniekus, ielaižamajiem akvakultūras dzīvniekiem ir atbilstošs veselības stāvoklis).

121. Ja jauna audzētava atbilst šo noteikumu 116.1. apakšpunktā un 117., 118., 119. un 120. punktā minētajām prasībām un atrodas iecirknī, kas pasludināts par infekcijas slimības neskartu, audzētavu uzskata par infekcijas slimības neskartu un tajā neņem paraugus, kas nepieciešami infekcijas slimības neskartas audzētavas statusa apstiprināšanai.

122. Ja audzētava, kas atbilst šo noteikumu 116.1. apakšpunktā un 117., 118., 119. un 120. punktā minētajām prasībām, atsāk darbu pēc pārtraukuma un atrodas iecirknī, kas pasludināts par infekcijas slimības neskartu, audzētavā neņem paraugus, kas nepieciešami infekcijas slimības neskartas audzētavas statusa apstiprināšanai, šādā gadījumā:

122.1. dienesta amatpersonai ir zināma audzētavas anamnēze par pēdējiem četriem darbības gadiem (ja audzētava darbojas mazāk nekā četrus gadus, ņem vērā tās reālo darbības laiku);

122.2. audzētava netika pakļauta šo noteikumu 1. pielikumā minēto infekcijas slimību apkarošanas pasākumiem un šīs infekcijas slimības audzētavā nav reģistrētas;

122.3. pirms akvakultūras dzīvnieku, olšūnu vai gametu ievešanas audzētava ir iztīrīta un dezinficēta, un kādu laiku nav izmantota.

XV. Uzraudzības organizēšana akvakultūras nozares uzņēmumos

123. Dienests audzētavu vai divvāku molusku audzēšanas zonu izvērtē atbilstoši riska pakāpēm, ņemot vērā infekcijas slimības izplatības iespējamību uz citām audzētavām vai divvāku molusku audzēšanas zonām. Dienests audzētavai vai divvāku molusku audzēšanas zonai piešķir augsta riska pakāpi, ja:

123.1. ir liela iespējamība izplatīt infekcijas slimības uz citām audzētavām vai savvaļas ūdensdzīvnieku populācijām vai inficēties ar tām no citām audzētavām vai savvaļas ūdensdzīvniekiem (notiek intensīva akvakultūras dzīvnieku kustība starp audzētavām, īpaši tādām, kurām nav noteikts statuss attiecībā uz infekcijas slimībām vai ir aizdomas par infekcijas slimībām);

123.2. audzēšanas apstākļi palielina infekcijas slimību uzliesmojuma iespējamību (liels biomasas apjoms (akvakultūras dzīvnieku blīvums ir lielāks par 60 kg/m3 ūdens), ūdens kvalitāte ir zema (ūdens laboratoriskajos izmeklējumos konstatētais mikroorganismu kopskaits divas reizes un vairāk pārsniedz pieļaujamo ūdens mikrobioloģisko piesārņojumu));

123.3. dzīvi ūdensdzīvnieki tiek pārdoti turpmākai audzēšanai vai krājumu atjaunošanai.

124. Vidēja riska pakāpi audzētavai vai divvāku molusku audzēšanas zonai dienests piešķir, ja:

124.1. ir vidēja iespējamība izplatīt infekcijas slimības uz citām audzētavām vai savvaļas ūdensdzīvnieku populācijām vai ir iespējamība inficēties no citām audzētavām vai savvaļas ūdensdzīvnieku resursiem (notiek akvakultūras dzīvnieku kustība starp audzētavām, kurām nav noteikts statuss attiecībā uz infekcijas slimībām);

124.2. audzēšanas apstākļi nepalielina infekcijas slimību uzliesmojuma iespējamību (vidējs biomasas apjoms (akvakultūras dzīvnieku blīvums ir 30–60 kg/m3 ūdens), ūdens kvalitāte ir vidēja (ūdens laboratoriskajos izmeklējumos konstatētais mikroorganismu kopskaits vienu līdz divas reizes pārsniedz ūdens mikrobioloģiskā piesārņojuma normu));

124.3. dzīvi ūdensdzīvnieki tiek pārdoti lietošanai pārtikā.

125. Zema riska pakāpi audzētavai vai divvāku molusku audzēšanas zonai dienests piešķir, ja:

125.1. ir maza iespējamība izplatīt infekcijas slimības uz citām audzētavām vai savvaļas ūdensdzīvnieku populācijām vai maza iespējamība inficēties no citām audzētavām vai savvaļas ūdensdzīvnieku resursiem (notiek akvakultūras dzīvnieku kustība starp audzētavām, kurām ir noteikts statuss attiecībā uz infekcijas slimībām);

125.2. audzēšanas apstākļi nepalielina infekcijas slimību uzliesmojuma iespējamību (mazs biomasas apjoms (akvakultūras dzīvnieku blīvums ir līdz 50 kg/m3 ūdens), laba ūdens kvalitāte (ūdens laboratoriskajos izmeklējumos atklātais mikroorganismu kopskaits nepārsniedz ūdens mikrobioloģiskā piesārņojuma normu);

125.3. dzīvi ūdensdzīvnieki tiek pārdoti lietošanai tikai pārtikā.

126. Īstenojot pasīvo uzraudzību, akvakultūras dzīvnieku īpašnieka vai turētāja pienākums ir nekavējoties informēt dienesta teritoriālo struktūrvienību par akvakultūras dzīvnieku saslimšanu un mirstības pieaugumu. Pēc paziņošanas veic šo noteikumu 47., 48., 49., 50., 51., 52. un 53. punktā minētos pasākumus. Informāciju par saslimšanu un mirstības pieaugumu akvakultūras dzīvnieku īpašnieks vai turētājs sniedz praktizējošam vai pilnvarotam veterinārārstam.

127. Aktīvā uzraudzība ietver:

127.1. regulāras pārbaudes, ko veic dienesta amatpersona vai pilnvarots veterinārārsts;

127.2. akvakultūras dzīvnieku populācijas pārbaudi attiecībā uz infekcijas slimībām;

127.3. paraugu ņemšanu laboratoriskiem izmeklējumiem, ja rodas aizdomas par kādu no šo noteikumu 1. pielikumā minētajām infekcijas slimībām vai ir konstatēts mirstības pieaugums;

127.4. ziņošanu dienesta teritoriālajai struktūrvienībai, ja laboratoriskajos izmeklējumos akvakultūras dzīvniekiem konstatēta infekcijas slimība vai ir aizdomas par to;

127.5. dienesta teritoriālās struktūrvienības informēšanu par mirstības pieaugumu. Informāciju par mirstības pieaugumu sniedz akvakultūras dzīvnieku īpašnieks vai turētājs praktizējošam vai pilnvarotam veterinārārstam.

128. Mērķtiecīgā uzraudzība ietver:

128.1. dienesta amatpersonas veiktas regulāras pārbaudes;

128.2. paraugu ņemšanu laboratoriskiem izmeklējumiem, lai noteiktu specifiskus patogēnus;

128.3. ziņošanu dienesta teritoriālajai struktūrvienībai, ja laboratoriskajos izmeklējumos akvakultūras dzīvniekiem konstatēta infekcijas slimība vai ir aizdomas par infekcijas slimību;

128.4. dienesta teritoriālās struktūrvienības informēšanu par akvakultūras dzīvnieku mirstības pieaugumu.

XVI. Prasības karantīnas punktiem un karantīnas punkta pārvaldības nosacījumi

129. Lai reģistrētu karantīnas punktu:

129.1. fiziskā vai juridiskā persona iesniedz dienestā iesniegumu;

129.2. dienests:

129.2.1. izsniedz saimnieciskās darbības veicējam prasību kopumu karantīnas punkta izveidei;

129.2.2. izskata dokumentus un izvērtē karantīnas punkta atbilstību šo noteikumu XVI nodaļā minētajām prasībām;

129.2.3. triju darbdienu laikā rakstiski paziņo pieņemto lēmumu karantīnas punkta īpašniekam.

130. Ja karantīnas punkta pārbaudes laikā konstatē:

130.1. neatbilstību šo noteikumu XVI nodaļā minētajām prasībām, dienesta amatpersona nereģistrē karantīnas punktu un nosaka termiņu pārkāpumu novēršanai. Minēto termiņu dienesta amatpersona saskaņo ar karantīnas punkta īpašnieku;

130.2. atbilstību šo noteikumu XVI nodaļā minētajām prasībām, dienesta amatpersona reģistrē karantīnas punktu, piešķirot reģistrācijas numuru, un pēc karantīnas punkta īpašnieka pieprasījuma izsniedz reģistrācijas apliecību. Dienests sastāda sarakstu ar reģistrētiem karantīnas punktiem un šo informāciju ievieto tīmekļvietnē.

131. Saimnieciskās darbības veicējs karantīnas punktu izveido kā atsevišķu uzņēmumu vai ierīko to audzētavas vai gliemju audzēšanas zonas teritorijā.

132. Karantīnas punkts atrodas dienesta noteiktā attālumā no citiem karantīnas punktiem, audzētavām vai gliemju audzēšanas zonām. Dienests attālumu starp karantīnas punktu un citām telpām, audzētavām vai gliemju audzēšanas zonām nosaka, pamatojoties uz riska novērtējumu un ņemot vērā šo noteikumu 1. pielikumā minēto akvakultūras dzīvnieku infekcijas slimību epizootoloģiju.

133. Karantīnas vienības ierīko tā, lai starp tām nebūtu iespējama ūdens apmaiņa. Ūdens izvades sistēmu izveido tā, lai nepieļautu karantīnas vienību vai citu tās pašas audzētavas vai gliemju audzēšanas zonas teritoriju savstarpēju inficēšanos.

134. Karantīnas vienībām piegādā ūdeni, kas ir šo noteikumu 1. pielikumā minēto akvakultūras dzīvnieku infekcijas slimību ierosinātāju neskarts.

135. Ja karantīnas punktu iekārto akvakultūras dzīvnieku infekcijas slimības (1. pielikums) neskartā Latvijas valsts teritorijā, zonā vai iecirknī (ir izpildītas šo noteikumu XIII nodaļā minētās prasības vai arī šajā teritorijā, zonā vai iecirknī tiek īstenota akvakultūras dzīvnieku infekcijas slimības uzraudzības vai apkarošanas programma), notekūdeņu attīrīšanas sistēmu tajā ierīko, ievērojot šādas prasības:

135.1. sistēma nodrošina visu karantīnas vienībā radīto notekūdeņu un atkritumu attīrīšanu tā, lai efektīvi iznīcinātu šo noteikumu 1. pielikumā minēto akvakultūras dzīvnieku infekcijas slimību ierosinātājus;

135.2. sistēma ir aprīkota ar rezerves drošības mehānismu, kas nodrošina nepārtrauktu tās darbību un notekūdeņu pilnīgu attīrīšanu.

136. Karantīnas vienību ierīko tā, lai novērstu karantīnā esošo dzīvnieku saskari ar citiem dzīvniekiem, kas var izplatīt akvakultūras dzīvnieku infekcijas slimības ierosinātājus.

137. Karantīnas punktā un karantīnas vienībā iekārtas ierīko tā, lai tās varētu iztīrīt un dezinficēt. Iekārtām ir atbilstošs tīrīšanas un dezinfekcijas aprīkojums.

138. Pie karantīnas punkta un karantīnas vienības ieejas un izejas novieto ar dezinficējošu šķidrumu piesūcinātu paklāju, lai iznīcinātu akvakultūras dzīvnieku infekcijas slimību ierosinātājus.

139. Katru karantīnas punkta vienību aprīko ar atsevišķām iekārtām, lai novērstu karantīnas vienību savstarpēju inficēšanos.

140. Karantīnas punkta īpašnieks slēdz līgumu ar dienesta pilnvarotu veterinārārstu.

141. Pirms katra jauna akvakultūras dzīvnieku sūtījuma ievietošanas karantīnas vienībā to tīra un dezinficē, un ne mazāk kā septiņas dienas tur tukšu.

142. Karantīnas laika uzskaite sākas pēc visu attiecīgā akvakultūras dzīvnieku sūtījuma dzīvnieku ievietošanas karantīnas vienībā.

143. Karantīnas punktā veic pasākumus, lai novērstu saņemto un nosūtīto akvakultūras dzīvnieku sūtījumu savstarpēju inficēšanos.

144. Karantīnas punktā un karantīnas vienībā atļauts ieiet personām, kuras veic ar akvakultūras dzīvnieku karantīnu saistītus darba pienākumus.

145. Ieejot karantīnas punktā un karantīnas vienībā, personas valkā aizsargapģērbu un aizsargapavus.

146. Nedrīkst būt saskare starp personālu vai iekārtām, kas rada savstarpēju inficēšanos starp karantīnas punktiem vai karantīnas vienībām vai starp karantīnas punktiem un audzētavām vai gliemju audzēšanas zonām.

147. Pēc akvakultūras dzīvnieku sūtījuma saņemšanas transportlīdzekļus, iekārtas, tvertnes, konteinerus un ūdeni apstrādā, lai iznīcinātu akvakultūras dzīvnieku infekcijas slimību ierosinātājus.

148. Paraugu ņemšanu, pārbaudi, laboratoriskos izmeklējumus un diagnostiku veic pilnvarots veterinārārsts, ievērojot dienesta norādījumus.

149. Papildus šo noteikumu 15., 16., 17. un 18. punktā minētajai uzskaitei karantīnas punktā reģistrē:

149.1. laiku, kad darbinieki ieiet tajā un iziet no tā;

149.2. piegādātā ūdens un notekūdeņu apstrādi;

149.3. visus ārkārtas apstākļus, kas ietekmē karantīnas procesu (piemēram, elektroenerģijas padeves pārtraukumus, ēku bojājumus, ārkārtējus laikapstākļus);

149.4. pārbaudei iesniegto paraugu ņemšanas datumu un pārbaužu rezultātus.

XVII. Prasības ievestu akvakultūras dzīvnieku ievietošanai karantīnā pirms to laišanas Eiropas Savienības ūdeņos

150. Ja Latvijā importē (ieved no trešajām valstīm) akvakultūras dzīvniekus, ko paredzēts ievietot karantīnā, importētājs vai tā pārstāvis iesniedz dienestā rakstisku apliecinājumu, ka izraudzītajā karantīnas punktā ievestos akvakultūras dzīvniekus pieņems un ievietos karantīnā saskaņā ar šo noteikumu prasībām (turpmāk – apliecinājums). Apliecinājumu paraksta karantīnas punkta īpašnieks vai tā pilnvarota persona.

151. Apliecinājumā norāda karantīnas punkta reģistrācijas numuru. Apliecinājumu noformē latviešu valodā vai tās Eiropas Savienības dalībvalsts oficiālajā valodā, kuras robežkontroles punktā veic veterinārās pārbaudes, un pievieno oficiālu tulkojumu latviešu valodā. Ja no trešajām valstīm importētā akvakultūras dzīvnieku sūtījuma galamērķis ir Latvijas Republika, apliecinājumu noformē atbilstoši normatīvajiem aktiem par valsts valodu.

152. Importētājs vai tā pārstāvis veic vienu no šādām darbībām:

152.1. iesniedz apliecinājumu robežkontroles punktā pirms akvakultūras dzīvnieku sūtījuma nonākšanas tajā;

152.2. uzrāda apliecinājumu robežkontroles punktā pirms akvakultūras dzīvnieku izlaišanas no robežkontroles punkta.

153. Importētos akvakultūras dzīvniekus no robežkontroles punkta pārved tieši uz karantīnas punktu. Ja šādai pārvadāšanai izmanto transportlīdzekļus, robežkontroles punktā dienesta amatpersona transportlīdzekļiem uzliek pret viltojumiem drošu plombu.

154. Par karantīnā ievietojamiem importētajiem akvakultūras dzīvniekiem:

154.1. robežkontroles punkta dienesta amatpersona, izmantojot datorizēto informācijas paziņošanas sistēmu (TRACES sistēma) (atbilstoši normatīvajiem aktiem par veterinārās kontroles kārtību, kas jāievēro, ievedot Latvijā dzīvniekus no trešajām valstīm, un Komisijas 2004. gada 30. marta Regulai (EK) Nr. 599/2004 par vienota parauga sertifikāta un inspekcijas ziņojuma ieviešanu Kopienas iekšējā tirdzniecībā ar dzīvniekiem un dzīvnieku izcelsmes produktiem), vienas darbdienas laikā informē dienesta amatpersonu, kuras uzraudzībā atrodas karantīnas punkts, norādot datumu, kad akvakultūras dzīvnieku sūtījums saņemts robežkontroles punktā, sūtījuma izcelsmes vietu un galamērķi;

154.2. karantīnas punkta īpašnieks vai tā pilnvarota persona vienas darbdienas laikā pēc akvakultūras dzīvnieku sūtījuma saņemšanas karantīnas punktā informē dienesta amatpersonu, kuras uzraudzībā atrodas karantīnas punkts, par sūtījuma saņemšanu (arī par to, ja sūtījums noteiktajā laikā nav saņemts);

154.3. dienesta amatpersona, kuras uzraudzībā atrodas karantīnas punkts, triju darbdienu laikā (skaitot no dienas, kad akvakultūras dzīvnieku krava ievesta karantīnas punkta teritorijā), izmantojot TRACES sistēmu, informē robežkontroles punkta dienesta amatpersonu par sūtījuma saņemšanu (arī par to, ja sūtījums noteiktajā laikā nav saņemts).

155. Ja robežkontroles punkta dienesta amatpersona saņem informāciju par to, ka akvakultūras dzīvnieki, kas deklarēti kā nosūtāmi uz karantīnas punktu, nav nonākuši galamērķī triju darbdienu laikā pēc noteiktās ierašanās dienas, tā informē dienestu un attiecīgo muitas iestādi par šo faktu. Dienests sadarbībā ar muitas iestādi veic pasākumus, lai nodrošinātu kravas atrašanu un ievietošanu karantīnā.

156. Lai akvakultūras dzīvniekus laistu tirgū saskaņā ar šo noteikumu 34., 35. vai 39. punktu vai akvakultūras dzīvnieku sūtījumu importētu saskaņā ar Komisijas 2008. gada 12. decembra Regulas (EK) Nr. 1251/2008, ar ko īsteno Padomes Direktīvu 2006/88/EK attiecībā uz nosacījumiem un sertifikācijas prasībām par akvakultūras dzīvnieku un to produktu laišanu tirgū un importu Kopienā un nosaka pārnēsātājsugu sarakstu (turpmāk – regula (EK) Nr. 1251/2008), IV nodaļu, akvakultūras dzīvnieku sūtījumam jāatbilst šādām prasībām:

156.1. visu karantīnas laiku sūtījums atrodas vienā karantīnas punktā;

156.2. uz akvakultūras dzīvnieku sugām, kas ir uzņēmīgas pret akvakultūras dzīvnieku infekcijas slimībām, attiecina šo noteikumu 160., 162., 163., 164., 165., 166. un 167. punktā minētās prasības;

156.3. uz akvakultūras dzīvnieku sugām, kas ir akvakultūras dzīvnieku infekcijas slimību pārnēsātājas, attiecina šo noteikumu 161., 162. un 163. punktā minētās prasības;

156.4. pēc karantīnas beigām dienesta amatpersona par katru akvakultūras dzīvnieku sūtījumu aizpilda un izsniedz aktu, kurā norāda informāciju par karantīnas punktu, karantīnas laiku, akvakultūras dzīvnieku sugu, skaitu, sūtījuma nosūtīšanas galamērķi, kā arī apliecinājumu, ka akvakultūras dzīvnieki ir klīniski veseli un tiem nav konstatētas šo noteikumu 1. pielikumā minētās akvakultūras dzīvnieku infekcijas slimības.

157. Ja karantīnas laikā rodas aizdomas par akvakultūras dzīvnieku saslimšanu ar kādu no šo noteikumu 1. pielikumā minētajām akvakultūras dzīvnieku infekcijas slimībām, dienesta amatpersona:

157.1. ņem paraugus un izmeklē tos akvakultūras dzīvnieku infekcijas slimību references laboratorijā, lai apstiprinātu vai noraidītu infekcijas slimības esību;

157.2. līdz diagnozes apstiprināšanai vai noraidīšanai aizliedz karantīnas punktā ievest un no tā izvest akvakultūras dzīvniekus.

158. Ja karantīnas laikā apstiprinās kāda no šo noteikumu 1. pielikumā minētajām akvakultūras dzīvnieku infekcijas slimībām, dienesta amatpersona kontrolē šādu prasību izpildi:

158.1. visus karantīnas vienībā esošos akvakultūras dzīvniekus izņem un iznīcina, ievērojot attiecīgās infekcijas slimības izplatīšanās iespējamību, izņemot gadījumu, ja akvakultūras dzīvniekus un to produktus laiž tirgū un karantīnas vienībā konstatētā akvakultūras dzīvnieku infekcijas slimība neapdraud ūdensdzīvnieku veselības stāvokli galamērķa teritorijā vai valstī;

158.2. infekcijas slimības skartās karantīnas vienības tīra un dezinficē;

158.3. 15 dienas pēc karantīnas vienības tīrīšanas un dezinfekcijas pabeigšanas tajā aizliegts ievietot akvakultūras dzīvniekus;

158.4. infekcijas slimības skartās karantīnas vienības ūdeni apstrādā un dezinficē, lai iznīcinātu konstatētās akvakultūras dzīvnieku infekcijas slimības ierosinātājus.

159. Dienests informē Eiropas Komisiju par pasākumiem, ko īsteno saskaņā ar šo noteikumu 157. un 158. punktu.

160. Dzīvnieku sugām, kas ir uzņēmīgas pret akvakultūras dzīvnieku infekcijas slimībām, nodrošina šādu karantīnas laiku:

160.1. zivīm – ne mazāk kā 60 dienas;

160.2. vēžveidīgajiem – ne mazāk kā 40 dienas;

160.3. gliemjiem – ne mazāk kā 90 dienas.

161. Dzīvnieku sugas, kas ir akvakultūras dzīvnieku infekcijas slimību pārnēsātājas, karantīnā tur ne mazāk kā 30 dienas. Šajā laikā ūdeni karantīnas vienībā maina ne retāk kā reizi dienā.

XVIII. Kontrole karantīnas laikā

162. Dienests akvakultūras dzīvnieku karantīnas laika sākumā un beigās kontrolē karantīnas nosacījumu izpildi. Kontrolējot pret akvakultūras dzīvnieku infekcijas slimībām uzņēmīgās sugas, dienests nodrošina tādus vides apstākļus, kas veicina šo noteikumu 1. pielikumā minēto akvakultūras dzīvnieku infekcijas slimību atklāšanu laboratoriskos izmeklējumos.

163. Veicot karantīnas nosacījumu kontroli, pārbauda:

163.1. karantīnas laikā nobeigušos dzīvnieku uzskaiti;

163.2. akvakultūras dzīvnieku veselības stāvokli karantīnas vienībā.

164. Lai apliecinātu šo noteikumu 1. pielikumā minēto akvakultūras dzīvnieku infekcijas slimību neesību, laboratorisko izmeklējumu rezultātiem jābūt negatīviem. Dienesta pilnvarots veterinārārsts, ievērojot dienesta noteikto paraugu ņemšanas procedūru, kā arī transportēšanas un diagnostikas procesu, paraugus ņem apstākļos, kas veicina šo infekcijas slimību atklāšanu. Paraugus 15 dienas pirms karantīnas laika beigām ņem:

164.1. no visiem akvakultūras kontroldzīvniekiem, ja tādus izmanto karantīnas laikā;

164.2. no atbilstoša akvakultūras dzīvnieku skaita, lai nodrošinātu attiecīgās sarakstā iekļautās infekcijas slimības atklāšanu ar ticamības līmeni 95 %, ja izplatības modelis ir 10 % un ja akvakultūras kontroldzīvnieki nav izmantoti (bet ne mazāk kā no 10 akvakultūras dzīvniekiem).

165. Akvakultūras kontroldzīvniekus atļauts izmantot analīžu veikšanai, paraugu ņemšanai un diagnostikai, izņemot gadījumu, ja karantīnā ir ievietotas akvakultūras dzīvnieku sugas, kas ir uzņēmīgas pret marteiliozes ierosinātāju Marteilia refringens.

166. Karantīnas laikā dienests nosaka akvakultūras kontroldzīvnieku skaitu, ņemot vērā karantīnā ievietoto akvakultūras dzīvnieku skaitu, karantīnas vienības lielumu, sugas īpatnības un akvakultūras dzīvnieku infekcijas slimības izplatības iespējamību.

167. Dienests kontrolē, lai karantīnā ievietotie akvakultūras kontroldzīvnieki atbilst šādām prasībām:

167.1. kontroldzīvnieki ir tādu sugu īpatņi, kas uzņēmīgi pret šo noteikumu 1. pielikumā minētajām akvakultūras dzīvnieku infekcijas slimībām un, ņemot vērā to turēšanas apstākļus, ir tajā attīstības posmā, kad uzņēmība pret šīm slimībām ir vislielākā;

167.2. kontroldzīvnieku izcelsmes dalībvalsts teritorija, zona, iecirknis vai trešā valsts vai tās daļa ir attiecīgās akvakultūras dzīvnieku infekcijas slimības neskarta;

167.3. kontroldzīvnieki nav vakcinēti pret attiecīgo akvakultūras dzīvnieku infekcijas slimību;

167.4. kontroldzīvnieki ir ievietoti karantīnas vienībā īsi pirms karantīnā ievietojamo akvakultūras dzīvnieku saņemšanas vai tās laikā un turēti kopā ar ievestajiem akvakultūras dzīvniekiem un tādos pašos zootehniskajos un vides apstākļos.

168. Nobeigušos vai slimos akvakultūras dzīvniekus izmeklē dienesta pilnvarots veterinārārsts.

169. Ja saskaņā ar regulas (EK) Nr. 1251/2008 IV nodaļu karantīna ir nosacījums akvakultūras dzīvnieku sūtījuma importam, šādu sūtījumu ieved, ja trešajās valstīs ir ievērotas prasības, kas līdzvērtīgas normatīvajos aktos par akvakultūras dzīvnieku karantīnu noteiktajām prasībām.

XIX. Prasības virālās hemorāģiskās septicēmijas un infekciozās hematopoētiskās nekrozes uzraudzības un apkarošanas programmai, lai iegūtu un saglabātu akvakultūras dzīvnieku veselības stāvokli "infekcijas slimības neskarts", un šo infekcijas slimību ierobežošanas pasākumi

170. Virālās hemorāģiskās septicēmijas un infekciozās hematopoētiskās nekrozes uzraudzība ietver šādas darbības:

170.1. vispārīgu akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 170. punktam;

170.2. specifisku akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 172., 173., 174., 175., 176., 177., 178., 179., 190., 181., 182., 183., 184., 185., 186., 187. un 188. punktam, lai iegūtu I kategoriju – veselības stāvoklis "infekcijas slimības neskarts" (turpmāk – I kategorija);

170.3. akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 189., 190. un 191. punktam, lai saglabātu I kategoriju;

170.4. tādu akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu, kuru mērķis ir atcelt ierobežošanas pasākumus, lai Latvijas valsts teritorijā, iecirknī vai zonā, kurai attiecībā uz virālo hemorāģisko septicēmiju vai infekciozo hematopoētisko nekrozi ir piešķirta veselības stāvoklim atbilstošā V kategorija (turpmāk – V kategorija), varētu piešķirt veselības stāvoklim atbilstošo III kategoriju (turpmāk – III kategorija) saskaņā ar šo noteikumu 192. punktā minētajām prasībām.

171. Virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes konstatēšanai organizē vispārīgas akvakultūras un ūdensdzīvnieku veselības pārbaudes šādā kārtībā:

171.1. akvakultūras dzīvnieku veselības pārbaudi organizē vai paraugus ņem sezonā, kad ūdens temperatūra ir zemāka par 14 °C, vai jebkurā laikā, kad ūdens temperatūra varētu būt sasniegusi gada zemāko vērtību;

171.2. Latvijas valsts daļā, kurā audzētavu vai divvāku molusku audzēšanas zonu nav daudz un to mērķtiecīga uzraudzība nesniedz pietiekami daudz epizootoloģisku datu, bet kurā ir vienas vai vairāku uzņēmīgu sugu savvaļas ūdensdzīvnieku populācijas, tām piemēro mērķtiecīgu uzraudzību. Paraugu ņemšanas punktu skaitu un ģeogrāfisko sadalījumu nosaka tā, lai būtu aptverta Latvijas valsts teritorija, zona vai iecirknis. Paraugu ņemšanas punkti pārstāv dažādas ekosistēmas, kurās atrodas pret akvakultūras dzīvnieku infekcijas slimību uzņēmīgo sugu savvaļas ūdensdzīvnieku populācijas;

171.3. audzētavā vai savvaļas ūdensdzīvnieku populācijā, kurā veselības pārbaudes organizē vai paraugus ņem vairāk nekā vienu reizi gadā, starp veselības pārbaudēm un paraugu ņemšanas reizēm ievēro četru mēnešu vai ilgāku starplaiku atkarībā no šo noteikumu 171.1. apakšpunktā minētās prasības par ūdens temperatūru;

171.4. akvakultūras dzīvnieku veselības pārbaudes izdara visās ražošanas vienībās – piemēram, dīķos, cisternās, tīklu būros, un noskaidro, vai vienībās nav beigtu vai novājinātu zivju vai zivju ar anormālu uzvedību. Īpašu uzmanību pievērš ūdens izplūdes zonai, kur novājinātu zivju straumes dēļ parasti uzkrājas vairāk;

171.5. uzņēmīgo sugu zivis paraugiem izvēlas šādi:

171.5.1. no zivīm, starp kurām ir varavīksnes foreles, paraugam ņem tikai šīs sugas zivis, ja nav citu uzņēmīgu sugu, kurām vērojamas tipiskas virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes pazīmes. Ja varavīksnes foreļu nav, ņem paraugu no visām citām pārstāvētajām uzņēmīgajām akvakultūras dzīvnieku sugām;

171.5.2. ja sastopamas novājinātas zivis, zivis ar anormālu uzvedību vai nesen nobeigušās, bet nesadalījušās zivis, izvēlas nesen nobeigušās zivis. Ja zivju audzēšanai izmanto vairāk nekā vienu ūdensapgādes avotu, paraugā iekļauj zivis no visiem ūdensapgādes avotiem;

171.5.3. zivis paraugam ņem tā, lai paraugā proporcionāli būtu pārstāvētas visas audzētavas daļas, kā arī visas zivju vecuma grupas.

172. Lai attiecībā uz virālo hemorāģisko septicēmiju un infekciozo hematopoētisko nekrozi iegūtu I kategoriju:

172.1. Latvijas valsts teritorijā, atsevišķā tās zonā vai iecirknī, kurā attiecībā uz virālo hemorāģisko septicēmiju vai infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām akvakultūras dzīvniekiem ir III kategorijai atbilstošs veselības stāvoklis un kurā atrodas audzētavas ar uzņēmīgajām akvakultūras dzīvnieku sugām un paraugu ņemšanas punkti savvaļas ūdensdzīvnieku populācijā, īsteno uzraudzības programmu. Pēc uzraudzības programmas īstenošanas Latvijas valsts teritorijai, tās zonai vai iecirknim dienests piešķir I kategoriju;

172.2. Latvijas valsts teritorijā, atsevišķā tās zonā vai iecirknī, kurā attiecībā uz virālo hemorāģisko septicēmiju vai infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām akvakultūras dzīvniekiem ir V kategorijai atbilstošs veselības stāvoklis un kurā atrodas audzētavas ar uzņēmīgajām akvakultūras dzīvnieku sugām un paraugu ņemšanas punkti savvaļas ūdensdzīvnieku populācijā, īsteno infekcijas slimību apkarošanas programmu.

173. Šo noteikumu 172.1. apakšpunktā minēto uzraudzības programmu īsteno divu vai četru gadu laikā.

174. Īstenojot divu gadu uzraudzības programmu, audzētavās vai paraugu ņemšanas punktos savvaļas ūdensdzīvnieku populācijā divus gadus pēc kārtas organizē veselības pārbaudes un, ievērojot šo noteikumu 4. pielikumā noteiktās prasības, ņem paraugus laboratoriskiem izmeklējumiem, lai šo noteikumu 5. pielikuma 2. un 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par virālo hemorāģisko septicēmiju vai infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām.

175. Īstenojot četru gadu uzraudzības programmu, audzētavās vai paraugu ņemšanas punktos savvaļas ūdensdzīvnieku populācijā četrus gadus pēc kārtas organizē veselības pārbaudes un, ievērojot šo noteikumu 6. pielikumā noteiktās prasības, ņem paraugus laboratoriskiem izmeklējumiem, lai šo noteikumu 5. pielikuma 2. un 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par virālo hemorāģisko septicēmiju vai infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām.

176. Ja divu vai četru gadu uzraudzības programmas īstenošanas laikā kādā no audzētavām tiek apstiprināta inficēšanās ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām, dienests anulē audzētavai piešķirto II kategoriju.

177. Dienests var atjaunot audzētavai II kategoriju un atļaut turpināt uzraudzības programmu, lai iegūtu I kategoriju, neīstenojot šo noteikumu 179., 180., 181., 182., 183., 184., 185., 186., 187. un 188. punktā minēto apkarošanas programmu, ja audzētava atbilst šādiem nosacījumiem:

177.1. ir kontinentāla audzētava, kurā akvakultūras dzīvnieku veselības stāvoklis attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām saskaņā ar šo noteikumu 113. punktu nav atkarīgs no apkārtējos dabiskajos ūdeņos esošo savvaļas ūdensdzīvnieku populāciju veselības stāvokļa attiecībā uz šīm infekcijas slimībām;

177.2. ir iztukšota, iztīrīta, dezinficēta un turēta neizmantota ne mazāk kā sešas nedēļas;

177.3. tās krājumi ir atjaunoti ar zivīm, kas iegūtas Eiropas Savienības dalībvalstīs, zonās vai iecirkņos, kuros attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām ir noteikta I kategorija.

178. Latvijas valsts teritorija, zona vai iecirknis, kurā attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām ir noteikta V kategorija, var iegūt I kategoriju, ja visās audzētavās, kurās attiecīgajā valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, ir īstenota apkarošanas programma.

179. Īstenojot apkarošanas programmu:

179.1. pēc neeksotisko infekcijas slimību konstatēšanas akvakultūras dzīvniekiem veic šo noteikumu VIII nodaļā minētos kontroles un apkarošanas pasākumus un:

179.2. saskaņā ar šo noteikumu 52.2. apakšpunktā minētajām prasībām izveido buferzonu, kurā ietilpst aizsardzības zona un uzraudzības zona;

179.3. veic šo noteikumu 180., 181., 182., 183., 184., 185., 186., 187. un 188. punktā minētos pasākumus.

180. Buferzonu nosaka katrā inficēšanās gadījumā atsevišķi, ņemot vērā riska faktorus, kas ietekmē infekcijas slimības izplatīšanos audzētavās audzētu zivju un savvaļas zivju populācijā:

180.1. zivju mirstība (pēc skaita), mirstības rādītāji un sadalījums pa sugām un slimībām (virālā hemorāģiskā septicēmija, infekciozā hematopoētiskā nekroze vai abas šīs infekcijas slimības) inficētajā audzētavā;

180.2. attālums līdz apkaimes audzētavām un to biezība;

180.3. attālums līdz tuvākajiem pārstrādes uzņēmumiem;

180.4. saskarē esošās audzētavas;

180.5. audzētavās pārstāvētās sugas;

180.6. infekcijas slimības skartajās audzētavās un to apkaimes audzētavās izmantotā audzēšanas prakse;

180.7. hidrodinamiskie apstākļi un citi konstatētie epizootoloģiski nozīmīgie faktori.

181. Veidojot aizsardzības zonu un uzraudzības zonu ap oficiāli deklarētu inficētu audzētavu, kurā konstatēta virālā hemorāģiskā septicēmija, infekciozā hematopoētiskā nekroze vai abas šīs infekcijas slimības, ievēro šādas minimālās ģeogrāfiskās norobežošanas prasības:

181.1. ap audzētavu izveido aizsardzības zonu, kas:

181.1.1. piekrastes teritorijā atbilst aplī norobežotai teritorijai, kuras rādiuss ir vienas plūdmaiņu joslas platums vai pieci kilometri (izmanto lielāko vērtību), vai norobežo līdzvērtīgu teritoriju, ko nosaka, pamatojoties uz attiecīgajiem hidrodinamiskajiem vai epizootoloģiskajiem datiem;

181.1.2. iekšzemes teritorijā atbilst audzētavai ar norobežotu visu ūdens sateces teritoriju. Dienests zonas plašumu var ierobežot tikai ar ūdens sateces teritorijas daļām vai ar audzētavas teritoriju, ja tas nepasliktina virālās hemorāģiskās septicēmijas, infekciozās hematopoētiskās nekrozes vai abu šo infekcijas slimību izplatības profilaksi;

181.2. ap audzētavu izveido uzraudzības zonu, kas piekrastes teritorijā atbilst aizsardzības zonu aptverošai teritorijai, kur vērojama plūdmaiņu joslu zonu pārklāšanās, vai aizsardzības zonu lokā aptverošai teritorijai 10 kilometru rādiusā no aizsardzības zonas centra, vai līdzvērtīgai teritorijai, ko nosaka, pamatojoties uz attiecīgajiem hidrodinamiskajiem vai epizootoloģiskajiem datiem;

181.3. iekšzemes teritorija atbilst paplašinātai teritorijai ārpus izveidotās aizsardzības zonas.

182. Aizsardzības zonā esošajās audzētavās, kurās tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas un kuras nav oficiāli deklarētas par inficētām ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām, veic oficiālu izmeklēšanu:

182.1. laboratoriskiem izmeklējumiem ņem 10 zivju paraugus, ja ir novērotas virālās hemorāģiskās septicēmijas, infekciozās hematopoētiskās nekrozes vai abām šīm infekcijas slimībām raksturīgās klīniskās vai pēcnāves (turpmāk – post mortem) pazīmes, vai ne mazāk kā 30 zivju paraugus, ja nav novērotas klīniskās vai post mortem pazīmes;

182.2. līdz aizsardzības zonas atcelšanai šo noteikumu 185. punktā minētajā kārtībā organizē veselības pārbaudes sezonā, kad ūdens temperatūra nepārsniedz 14 °C. Pēc tam veselības pārbaudes atkarībā no laboratorisko izmeklējumu rezultātiem turpina veikt reizi mēnesī, ja vien zivju dīķi vai tīklu būri nav klāti ar ledu.

183. Visas audzētavas, kas oficiāli deklarētas par inficētām ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām, iztukšo, iztīra, dezinficē un neizmanto ne mazāk kā sešas nedēļas. Kad visas vienā un tajā pašā aizsardzības zonā oficiāli deklarētās inficētās audzētavas ir iztukšotas, ievēro ne mazāk kā trīs nedēļas ilgu sinhronizētu neizmantošanas periodu. Kad oficiāli deklarētajās inficētajās audzētavās ir pagājis neizmantošanas periods, aizsardzības zonu pārveido par uzraudzības zonu.

184. Dienests izveidotajās aizsardzības un uzraudzības zonās arī citām audzētavām var piemērot prasību tās iztukšot, iztīrīt, dezinficēt un neizmantot, ja tiek novēroti infekcijas slimības turpmāki uzliesmojumi citās līdz šim neinficētās audzētavās. Neizmantošanas perioda ilgumu dienests nosaka, izvērtējot audzētavu inficēšanās risku katrā gadījumā atsevišķi, bet tas nav īsāks par sešām nedēļām.

185. Visās oficiāli deklarētajās inficētajās audzētavās un visās citās šo noteikumu 173. punktā minētajās aizsardzības un uzraudzības zonās esošajās audzētavās, kas turētas neizmantotas, krājumus atjauno ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņiem, kuros attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām ir noteikta I kategorija.

186. Krājumus atjauno tikai pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un beidzies to neizmantošanas periods atbilstoši šo noteikumu 183. punktam.

187. Uz visām audzētavām, kurās apkarošanas programmas aptvertajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, un, ja nepieciešama savvaļas ūdensdzīvnieku populāciju uzraudzība, uz tiem paraugu ņemšanas punktiem savvaļas ūdensdzīvnieku populācijā, kuri izraudzīti saskaņā ar šo noteikumu 171. punktu, pēc apkarošanas programmas īstenošanas attiecina divu vai četru gadu uzraudzības programmas un šo noteikumu 174., 175., 176. un 177. punktā minētās prasības.

188. Kontinentālam iecirknim, kas sastāv no vienas audzētavas, kuru neietekmē apkārt esošie dabiskie ūdeņi un kurai saistībā ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām ir atcelta I kategorija, dienests to var atjaunot, ja ir izpildīti šādi nosacījumi:

188.1. iecirknis ir iztukšots, iztīrīts, dezinficēts un netika izmantots vismaz sešas nedēļas;

188.2. zivju krājumi atjaunoti ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņa, kurā attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām ir noteikta I kategorija.

189. Ja I kategorijas saglabāšanai ir nepieciešama mērķtiecīga uzraudzība, visās audzētavās, kurās Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, organizē veselības pārbaudes un ņem zivju paraugus saskaņā ar šo noteikumu 7. pielikumu atkarībā no audzētavas riska pakāpes attiecībā uz inficēšanos ar minētajām infekcijas slimībām.

190. Iecirknī, kurā noteikta I kategorija un kurš atrodas kontinentālā zonā, risks inficēties ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām uzskatāms par augstu, ja veselības stāvoklis tajā ir atkarīgs no apkārtējos dabiskajos ūdeņos esošo savvaļas ūdensdzīvnieku populāciju veselības stāvokļa. Šo vērtējumu ņem vērā, nosakot veselības pārbaužu biežumu minētajos iecirkņos.

191. I kategoriju saglabā līdz brīdim, kamēr par visiem paraugiem, kas laboratoriski izmeklēti, izmantojot šo noteikumu 5. pielikuma 2. punktā noteiktās diagnostikas metodes, ir iegūti negatīvi rezultāti attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām un izslēgtas jebkuras aizdomas par tām, izmantojot šo noteikumu 5. pielikuma 3. punktā noteiktās diagnostikas metodes.

192. Latvijas valsts teritorija, zona vai iecirknis, kurā saistībā ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām ir noteikta V kategorija, var iegūt III kategoriju, ja:

192.1. ir izpildītas šo noteikumu 178., 179., 180., 181., 182., 183. un 184. punktā minētās prasības. Ja tehnisku iemeslu dēļ nav iespējams ievērot neizmantošanas periodu, attiecīgajā valsts teritorijā, zonā vai iecirknī īsteno kādu alternatīvu pasākumu, kas nodrošina līdzvērtīgu infekciozās hematopoētiskās nekrozes vīrusa, virālās hemorāģiskās septicēmijas vīrusa vai to abu iznīcināšanu audzētavu vidē;

192.2. oficiāli deklarētajās inficētajās audzētavās un visās citās aizsardzības un uzraudzības zonās esošajās audzētavās, kurās ir beidzies neizmantošanas periods vai ir īstenots šo noteikumu 192.1. apakšpunktā minētais alternatīvais pasākums, krājumi ir atjaunoti ar zivīm, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kurā saistībā ar virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām noteikta I, II vai III kategorija;

192.3. audzētavu zivju krājumi atjaunoti tikai pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods vai ir īstenots šo noteikumu 192.1. apakšpunktā minētais alternatīvais pasākums.

XX. Prasības koiju herpesvīrusa slimības uzraudzības un apkarošanas programmai, lai iegūtu un saglabātu akvakultūras dzīvnieku veselības stāvokli "infekcijas slimības neskarts", un šīs infekcijas slimības ierobežošanas pasākumi

193. Koiju herpesvīrusa slimības uzraudzība ietver šādas darbības:

193.1. akvakultūras un ūdensdzīvnieku vispārīgu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 193., 194., 195., 196., 197. un 198. punktam;

193.2. specifisku akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 200., 201., 202., 203., 204., 205., 206. un 207. punktam, lai iegūtu I kategoriju;

193.3. akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 208., 209., 210., 211. un 212. punktam, lai saglabātu I kategoriju;

193.4. akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 213. punktam, lai atceltu ierobežošanas pasākumus un Latvijas valsts teritorijā, iecirknī vai zonā, kam saistībā ar koiju herpesvīrusa slimību piešķirta V kategorija, varētu piešķirt III kategoriju.

194. Īstenojot mērķtiecīgu savvaļas ūdensdzīvnieku populāciju uzraudzību, paraugu ņemšanas punktu skaitu un ģeogrāfisko sadalījumu nosaka tā, lai būtu aptverta Latvijas valsts teritorija, zona vai iecirknis. Paraugu ņemšanas punkti pārstāv dažādas ekosistēmas – upju sistēmas un ezerus, kuros atrodas savvaļas ūdensdzīvnieku uzņēmīgās populācijas.

195. Īstenojot mērķtiecīgu uzraudzību, sezonā, kad ūdens temperatūra ir sasniegusi vismaz 15 °C, bet ne agrāk kā divas nedēļas no šī brīža, regulāri uzrauga uzņēmīgu savvaļas ūdensdzīvnieku sugu uzturēšanās vietas. Paraugam un laboratoriskai izmeklēšanai ņem uzraudzības vietā atrastās slimās zivis vai zivis ar anormālu izturēšanos.

196. Šo noteikumu 195. punktā minētās mērķtiecīgas uzraudzības ietvaros paraugus ņem no zivīm, kas vismaz divas līdz trīs nedēļas turētas 15 līdz 26 °C temperatūrā. Ja mērķtiecīgas uzraudzības ietvaros no zivīm nav iespējams paņemt paraugus, kā tas ir minēts iepriekš, tad paraugus ņem vienā no šādiem gadījumiem:

196.1. laikā, kad zivis tiek pārceltas no ziemas uz vasaras dīķiem, ievāc subpopulāciju, ko patur tajā pašā vasaras dīķī, līdz temperatūra atbilst minimālajām prasībām;

196.2. zivju produkcijas ievākšanas laikā vai laikā, kad ar zivīm veic citas manipulācijas atbilstoši parastajai audzēšanas praksei. Lai koiju herpesvīrusa slimības konstatēšanas iespēja būtu lielāka, paraugus, ja vien iespējams, ievāc 24 līdz 72 stundas pēc attiecīgajām manipulācijām.

197. Ja audzētavā vai savvaļas ūdensdzīvnieku populācijā mērķtiecīgu veselības pārbaudi organizē vai paraugus ņem biežāk nekā reizi gadā, to ar iespējami ilgiem starplaikiem dara sezonā, kad ūdens temperatūra varētu būt sasniegusi gada augstāko rādītāju, bet ne vairāk par 28 °C.

198. Mērķtiecīgas veselības pārbaudes izdara visās ražošanas vienībās – dīķos un cisternās, lai noskaidrotu, vai tajās nav beigtu vai novājinātu zivju vai zivju ar anormālu izturēšanos. Ievāc Cyprinus carpio un tās hibrīdus (piemēram, Cyprinus carpio × Carassius auratus), ja tādi ir audzētavā.

199. Mērķtiecīgā veselības pārbaudē paraugiem ņemamās zivis izraugās šādi:

199.1. ņem novājinātas zivis, zivis ar anormālu uzvedību vai nesen nobeigušās, bet nesadalījušās zivis, ja tādas ir sastopamas;

199.2. ja zivju audzēšanai izmanto vairāk nekā vienu ūdensapgādes avotu, paraugos iekļauj zivis no visiem ūdensapgādes avotiem;

199.3. zivis ņem tā, lai paraugā proporcionāli būtu pārstāvētas visas audzētavas daļas, kā arī visas zivju vecuma grupas.

200. Latvijas valsts teritorija, zona vai iecirknis, kam saistībā ar koiju herpesvīrusa slimību ir piešķirta III kategorija, var iegūt I kategoriju, ja valsts teritorijā, zonā vai iecirknī, kurā tiek turētas pret koiju herpesvīrusu uzņēmīgās akvakultūras dzīvnieku sugas:

200.1. visas audzētavas atbilst šo noteikumu XIV nodaļā minētajām prasībām;

200.2. visās audzētavās īsteno divu vai četru gadu uzraudzības programmu, kas attiecas arī uz paraugu ņemšanas punktiem savvaļas ūdensdzīvnieku populācijā, ja Latvijas valsts teritorijas daļā audzētavu vai divvāku molusku audzēšanas zonu mērķtiecīga uzraudzība nesniedz pietiekami daudz epizootoloģisku datu un ja ūdensdzīvnieku populācijās atrod vienu vai vairākas uzņēmīgu dzīvnieku sugas.

201. Īstenojot divu gadu uzraudzības programmu, audzētavā vai paraugu ņemšanas punktā savvaļas ūdensdzīvnieku populācijā divus gadus pēc kārtas:

201.1. organizē veselības pārbaudes un ņem paraugus saskaņā ar šo noteikumu 8. pielikuma 2.A tabulā noteiktajām prasībām;

201.2. paraugus laboratoriski izmeklē ar šo noteikumu 8. pielikuma 2. punktā norādīto diagnostikas metodi, lai 8. pielikuma 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par koiju herpesvīrusa slimību.

202. Īstenojot četru gadu uzraudzības programmu, audzētavā vai paraugu ņemšanas punktā savvaļas ūdensdzīvnieku populācijā četrus gadus pēc kārtas:

202.1. organizē veselības pārbaudes un ņem paraugus saskaņā ar šo noteikumu 8. pielikuma 2.B tabulā noteiktajām prasībām;

202.2. paraugus laboratoriski izmeklē, izmantojot šo noteikumu 8. pielikuma 2. punktā norādīto diagnostikas metodi, lai 7. pielikuma 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par koiju herpesvīrusa slimību;

202.3. uzraudzībai var izmantot mazāk paraugu saskaņā ar šo noteikumu 8. pielikuma 2.B tabulā noteiktajām prasībām.

203. Audzētava, kurā četru gadu uzraudzības programmas īstenošanas laikā ir apstiprināta inficēšanās ar koiju herpesvīrusu un kurai ir atcelta II kategorija, var to atgūt un turpināt uzraudzības programmas īstenošanu, lai iegūtu I kategoriju, neīstenojot apkarošanas programmu, ja audzētava:

203.1. ir kontinentāla audzētava, kurā veselības stāvoklis attiecībā uz koiju herpesvīrusa slimību nav atkarīgs no apkārtējā dabiskajā ūdenī esošo savvaļas ūdensdzīvnieku populāciju veselības stāvokļa attiecībā uz šo infekcijas slimību;

203.2. ir iztukšota, iztīrīta, dezinficēta un turēta neizmantota ne mazāk kā sešas nedēļas;

203.3. krājumus ir atjaunojusi ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņa, kuram saistībā ar koiju herpesvīrusa slimību ir noteikta I kategorija.

204. Latvijas valsts teritorija, zona vai iecirknis, kam saistībā ar koiju herpesvīrusa slimību ir noteikta V kategorija, var iegūt I kategoriju, ja visās audzētavās, kurās valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, ir īstenota šāda apkarošanas programma:

204.1. ir veikti šo noteikumu VIII nodaļā minētie kontroles pasākumi un apkarošanas pasākumi pēc neeksotisko infekcijas slimību konstatēšanas akvakultūras dzīvniekiem un oficiāli deklarētās inficētās audzētavas apkaimē ir izveidota buferzona, kurā ietilpst aizsardzības zona un uzraudzības zona;

204.2. visās aizsardzības zonā esošajās audzētavās, kurās tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas un kuras nav oficiāli deklarētas par inficētām ar koiju herpesvīrusu, veic oficiālu izmeklēšanu:

204.2.1. laboratoriskiem izmeklējumiem ņem 10 zivju paraugus, ja ir novērotas koiju herpesvīrusa slimībai raksturīgas klīniskas vai post mortem pazīmes, vai 30 zivju paraugus, ja nav novērotas klīniskās vai post mortem pazīmes;

204.2.2. līdz aizsardzības zonas atcelšanai sezonā, kad ūdens temperatūra varētu būt sasniegusi 15 °C, reizi mēnesī organizē veselības pārbaudes un ņem paraugus laboratoriskiem izmeklējumiem atbilstoši šo noteikumu 8. pielikuma 3. punktam;

204.3. visas audzētavas, kas oficiāli deklarētas par inficētām ar koiju herpesvīrusu, iztukšo, iztīra, dezinficē un neizmanto vismaz sešas nedēļas. Kad visas vienā un tajā pašā aizsardzības zonā esošās oficiāli deklarētās inficētās audzētavas ir iztukšotas, ievēro ne mazāk kā trīs nedēļas ilgu sinhronizētu neizmantošanas periodu. Pēc neizmantošanas perioda beigām aizsardzības zonu pārveido par uzraudzības zonu. Dienests izveidotās aizsardzības un uzraudzības zonas robežās, ja tiek novēroti infekcijas slimības turpmāki uzliesmojumi citās līdz šim neinficētās audzētavās, var noteikt arī citu audzētavu iztukšošanu, iztīrīšanu, dezinficēšanu un neizmantošanu. Neizmantošanas perioda ilgumu dienests nosaka, izvērtējot audzētavu inficēšanās risku katrā gadījumā atsevišķi, un šis neizmantošanas periods ir ne mazāk kā sešas nedēļas ilgs;

204.4. visās oficiāli deklarētajās inficētajās audzētavās un visās citās aizsardzības un uzraudzības zonās esošajās audzētavās, kurās beidzies neizmantošanas periods, zivju krājumus atjauno vienā no šādiem veidiem:

204.4.1. ar zivīm, kas iegūtas no Eiropas Savienības dalībvalstīm, zonām vai iecirkņiem, kuros saistībā ar koiju herpesvīrusa slimību ir noteikta I kategorija;

204.4.2. pārejas periodā līdz 2020. gada 31. decembrim – ar zivīm no Eiropas Savienības dalībvalstīm, zonām vai iecirkņiem, kuros tiek īstenota Eiropas Komisijā apstiprināta koiju herpesvīrusa slimības uzraudzības programma;

204.5. zivju krājumi ir atjaunoti tikai pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un saskaņā ar šo noteikumu 204.3. apakšpunktu ir beidzies to neizmantošanas periods;

204.6. visās audzētavās pēc apkarošanas programmas pabeigšanas īsteno divu vai četru gadu uzraudzības programmu, kas attiecas arī uz paraugu ņemšanas punktiem savvaļas ūdensdzīvnieku populācijā, ja Latvijas valsts teritorijas daļā audzētavu vai divvāku molusku audzēšanas zonu mērķtiecīga uzraudzība nesniedz pietiekami daudz epizootoloģisku datu un ja ūdensdzīvnieku populācijās atrod vienu vai vairākas uzņēmīgu dzīvnieku sugas.

205. Buferzonu nosaka katrā inficēšanās gadījumā atsevišķi, ņemot vērā riska faktorus, kas ietekmē koiju herpesvīrusa izplatīšanos audzētavas zivju un savvaļas zivju populācijā:

205.1. zivju mirstība (pēc skaita);

205.2. mirstības rādītāji un sadalījums pa sugām un slimībām ar koiju herpesvīrusu inficētajā audzētavā;

205.3. attālums līdz apkaimes audzētavām un to izvietojuma blīvums;

205.4. attālums līdz tuvākajām kautuvēm;

205.5. saskarē esošās audzētavas;

205.6. audzētavās pārstāvētās sugas;

205.7. infekcijas slimības skartajās audzētavās un apkaimes audzētavās izmantotā audzēšanas prakse;

205.8. hidrodinamiskie apstākļi;

205.9. citi epizootoloģiski nozīmīgi faktori.

206. Veidojot aizsardzības zonu un uzraudzības zonu, ievēro šādas ģeogrāfiskās norobežošanas prasības:

206.1. ap oficiāli deklarētu inficētu audzētavu, kurā konstatēts koiju herpesvīruss, izveido aizsardzības zonu, kas atbilst visai inficētās audzētavas ūdens sateces teritorijai. Dienests zonu var attiecināt tikai uz ūdens sateces teritorijas daļām, ja tas nepasliktina koiju herpesvīrusa slimības izplatības profilaksi;

206.2. ārpus aizsardzības zonas izveido uzraudzības zonu, kas atbilst paplašinātajai teritorijai, kura aptver izveidoto aizsardzības zonu.

207. Kontinentālā iecirknī, kas sastāv tikai no vienas audzētavas, kurai saistībā ar koiju herpesvīrusa slimību ir atcelta I kategorija un kurā veselības stāvokli neietekmē apkārt esošie dabiskie ūdeņi, dienests var atjaunot I kategoriju, ja ir izpildīti šādi nosacījumi:

207.1. iecirknis ir iztukšots, iztīrīts, dezinficēts un ir beidzies vismaz sešu nedēļu ilgs neizmantošanas periods;

207.2. zivju krājumi atjaunoti ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņa, kuram ir noteikta I kategorija, vai no iecirkņa, kurā īsteno koiju herpesvīrusa slimības uzraudzības programmu (II kategorija).

208. Ja I kategorijas saglabāšanai ir nepieciešama mērķtiecīga uzraudzība, visās audzētavās, kurās attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, organizē veselības pārbaudes un ņem paraugus saskaņā ar 8. pielikuma 2.B tabulā noteiktajām prasībām atkarībā no audzētavas riska pakāpes attiecībā uz inficēšanos ar koiju herpesvīrusu.

209. Kontinentālā iecirknī, kuram attiecībā uz koiju herpesvīrusa slimību ir piešķirta I kategorija, nosakot veselības pārbaužu biežumu, ņem vērā apkārtējos dabiskajos ūdeņos esošo ūdensdzīvnieku veselības stāvokli attiecībā uz minēto slimību. Šajā iecirknī veselības pārbaudes organizē saskaņā ar šo noteikumu 8. pielikuma 2.C tabulā noteiktajām prasībām, kas attiecas uz augstu riska pakāpi.

210. Ja Latvijas valsts teritorijā, zonā vai iecirknī audzētavu ir maz un to mērķtiecīga uzraudzība nenodrošina pietiekami daudz epizootoloģisku datu, lai saglabātu I kategoriju, uzraudzības programmā iekļauj paraugu ņemšanas punktus savvaļas ūdensdzīvnieku populācijā.

211. Pusi no šo noteikumu 210. punktā minētajiem paraugu ņemšanas punktiem katru gadu maina. Paraugus ņem un laboratoriski izmeklē saskaņā ar šo noteikumu 8. pielikuma 2.C tabulu un šā pielikuma 1. un 2. punktu.

212. I kategoriju saglabā līdz brīdim, kamēr par visiem paraugiem, kas laboratoriski izmeklēti, ievērojot šo noteikumu 8. pielikuma 1. un 2. punktā minētās prasības, ir iegūti negatīvi rezultāti un atbilstoši šo noteikumu 8. pielikuma 3. punktam izslēgtas aizdomas par koiju herpesvīrusa slimību.

213. Latvijas valsts teritorija, zona vai iecirknis, kurā attiecībā uz koiju herpesvīrusa slimību ir noteikta V kategorija, var iegūt III kategoriju, ja:

213.1. ir izpildītas šo noteikumu 204.1., 204.2. un 204.3. apakšpunktā, kā arī 205. un 206. punktā minētās prasības. Ja neizmantošanas periodu tehnisku iemeslu dēļ nav iespējams ievērot, attiecīgajā valsts teritorijā, zonā vai iecirknī īsteno kādu alternatīvu pasākumu, kas nodrošina līdzvērtīgu koiju herpesvīrusa iznīcināšanu audzētavu vidē;

213.2. visās oficiāli deklarētajās inficētajās audzētavās un visās citās aizsardzības un uzraudzības zonās esošajās audzētavās, kurās pagājis neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 212.1. apakšpunktu, krājumi ir atjaunoti ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņa, kam noteikta I, II vai III kategorija attiecībā uz koiju herpesvīrusa slimību;

213.3. audzētavu zivju krājumi atjaunoti tikai pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 213.1. apakšpunktu.

XXI. Prasības infekciozās lašu anēmijas uzraudzības un apkarošanas programmai, lai iegūtu un saglabātu akvakultūras dzīvnieku veselības stāvokli "infekcijas slimības neskarts" un ierobežotu inficēšanos ar Isavirus ģints vīrusu, kura genomā nav izteikti polimorfiska reģiona (infekciozā lašu anēmija bez izteikti polimorfiska reģiona (IPR))

214. Infekciozās lašu anēmijas uzraudzība ietver šādas darbības:

214.1. akvakultūras un ūdensdzīvnieku vispārīgu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 215. un 216. punktam;

214.2. specifisku akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 217., 218. un 219. punktam, lai iegūtu I kategoriju;

214.3. akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 220., 221. un 222. punktam, lai saglabātu I kategoriju;

214.4. akvakultūras un ūdensdzīvnieku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 223. punktam, lai atceltu ierobežošanas pasākumus un Latvijas valsts teritorijā, zonā vai iecirknī, kam attiecībā uz infekciozo lašu anēmiju (bez IPR) piešķirta V kategorija, varētu piešķirt III kategoriju.

215. Lai nodrošinātu infekciozās lašu anēmijas uzraudzību, akvakultūras dzīvnieku vispārīgās veselības pārbaudes organizē šādā kārtībā:

215.1. ja audzētavā, īstenojot mērķtiecīgu uzraudzību, veselības pārbaudes organizē un paraugus ņem biežāk nekā reizi gadā, nosaka pietiekami ilgus starplaikus starp veselības pārbaudēm vai paraugu ņemšanu;

215.2. ja ir nepieciešama mērķtiecīga savvaļas ūdensdzīvnieku populācijas veselības uzraudzība, paraugu ņemšanas punktu skaitu un ģeogrāfisko sadalījumu nosaka tā, lai būtu aptverta Latvijas valsts teritorija, zona vai iecirknis. Paraugu ņemšanas punkti pārstāv dažādas ekosistēmas, kurās atrodas uzņēmīgās savvaļas ūdensdzīvnieku populācijas;

215.3. ja veselības pārbaudes veic ražošanas vienībās – piemēram, dīķos, cisternās, tīklu būros –, noskaidro, vai tajos nav beigtu vai novājinātu zivju vai zivju ar anormālu izturēšanos. Īpašu uzmanību pievērš ūdens izplūdes zonai, kur vairāk novājinātu zivju uzkrājas straumes dēļ.

216. Zivis paraugiem izvēlas šādi:

216.1. ņem tikai mirstošas vai nobeigušās, bet nesadalījušās zivis. Priekšroku dod zivīm, kurām vērojama anēmija, asiņošana vai citas klīniskas pazīmes, kas liecina par asinsrites traucējumiem;

216.2. ja paraugu ņemšanas vietā uzņēmīgo sugu vidū ir Atlantijas lasis, priekšroku dod Atlantijas laša paraugiem. Ja audzētavā Atlantijas lašu nav, paraugus ņem no citām uzņēmīgajām sugām;

216.3. ja zivju audzēšanai izmanto vairāk nekā vienu ūdensapgādes avotu, paraugā iekļauj zivis no visiem ūdensapgādes avotiem;

216.4. zivis ņem tā, lai paraugā proporcionāli būtu pārstāvētas visas audzētavas ražošanas vienības – piemēram, dīķi, cisternas, tīklu būri –, kā arī visas zivju vecumgrupas.

217. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz infekciozo lašu anēmiju (bez IPR) ir noteikta III kategorija, var iegūt I kategoriju, ja visas audzētavas, kurās attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, atbilst šo noteikumu XIII nodaļas prasībām un ja tajās, kā arī paraugu ņemšanas punktos savvaļas ūdensdzīvnieku populācijā ir īstenota šāda uzraudzības programma:

217.1. divus gadus pēc kārtas ir veiktas veselības pārbaudes un ņemti paraugi, kā noteikts šo noteikumu 9. pielikuma 3.A tabulā;

217.2. divu gadu uzraudzības programmas darbības periodā visu paraugu laboratoriskajos izmeklējumos ar šo noteikumu 9. pielikuma 3., 4. un 5. punktā noteiktajām diagnostikas metodēm attiecībā uz ILA (bez IPR) ir iegūti negatīvi rezultāti un izslēgtas jebkuras aizdomas par infekciozo lašu anēmiju, īstenojot šo noteikumu 9. pielikuma 6. punktā noteiktās diagnostikas procedūras;

217.3. ja uzraudzības programmas īstenošanas laikā kādā audzētavā ir apstiprināta infekciozā lašu anēmija un II kategorija ir atcelta, īsteno apkarošanas programmu saskaņā ar šo noteikumu 218. un 219. punktu.

218. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz infekciozo lašu anēmiju (bez IPR) ir noteikta V kategorija, var iegūt I kategoriju, ja visā Latvijas valsts teritorijā, zonā vai iecirknī esošajās audzētavās, kurās tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, ir īstenota šāda apkarošanas programma:

218.1. ir veikti šo noteikumu VI nodaļā minētie kontroles un apkarošanas pasākumi pēc eksotisko infekcijas slimību konstatēšanas akvakultūras dzīvniekiem un to audzētavu apkaimē, kuras oficiāli deklarētas par inficētām ar infekciozo lašu anēmiju (bez IPR) vai kurās apstiprināta infekciozās lašu anēmijas klātbūtne, ir izveidota buferzona, kurā ietilpst aizsardzības zona un uzraudzības zona;

218.2. buferzona noteikta katrā inficēšanās gadījumā atsevišķi, ņemot vērā riska faktorus, kas ietekmē infekciozās lašu anēmijas izplatīšanos audzētavas zivju vai savvaļas zivju populācijā:

218.2.1. ar infekciozās lašu anēmijas (bez IPR) genotipam piederīgu infekciozās lašu anēmijas vīrusu inficētu vai ar apstiprinātu infekciozās lašu anēmijas slimu zivju mirstība (pēc skaita), mirstības rādītāji un sadalījums pa sugām un slimībām inficētajā audzētavā;

218.2.2. attālums līdz apkaimes audzētavām un to izvietojuma blīvums;

218.2.3. attālums līdz tuvākajiem pārstrādes uzņēmumiem;

218.2.4. saskarē esošās audzētavas;

218.2.5. audzētavās pārstāvētās sugas;

218.2.6. infekcijas slimības skartajās audzētavās un to apkaimes audzētavās izmantotā audzēšanas prakse;

218.2.7. hidrodinamiskie apstākļi un citi epizootoloģiski nozīmīgi faktori;

218.3. izveidotajā aizsardzības zonā un uzraudzības zonā ievēro šādas ģeogrāfiskās norobežošanas prasības:

218.3.1. ap oficiāli deklarētu inficētu audzētavu, kurā konstatēta infekciozā lašu anēmija, izveido aizsardzības zonu, kas piekrastes teritorijās atbilst aplī norobežotai teritorijai, kuras rādiuss ir vienas plūdmaiņu joslas platums vai pieci kilometri (izmanto lielāko vērtību) ar audzētavu centrā, vai līdzvērtīgai teritorijai, kura noteikta, pamatojoties uz hidrodinamiskiem vai epizootoloģiskiem datiem. Iekšzemē tā ir visa ūdens sateces teritorija, kas atbilst audzētavai, kura oficiāli deklarēta par inficētu ar infekciozo lašu anēmiju. Dienests aizsardzības zonu var attiecināt tikai uz ūdens sateces teritorijas daļām, ja ar to netiek pasliktināta infekciozās lašu anēmijas izplatības profilakse;

218.3.2. ap aizsardzības zonu izveido uzraudzības zonu, kas piekrastes teritorijās atbilst aplī norobežotai teritorijai, kurā vērojama plūdmaiņu joslu zonu pārklāšanās, vai aizsardzības zonu aptverošu teritoriju, kas ietilpst aplī, kura rādiuss ir 10 kilometri no aizsardzības zonas centra, vai līdzvērtīgu teritoriju, ko nosaka, pamatojoties uz hidrodinamiskiem vai epizootoloģiskiem datiem. Iekšzemē tā ir paplašināta teritorija ārpus izveidotās aizsardzības zonas;

218.4. aizsardzības zonā esošajās audzētavās, kurās tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas un kuras nav oficiāli deklarētas par inficētām ar infekciozo lašu anēmiju, veic oficiālu izmeklēšanu:

218.4.1. ņem vismaz 10 mirstošu zivju paraugus laboratoriskiem izmeklējumiem, ja novērotas infekciozajai lašu anēmijai raksturīgās klīniskas vai post mortem pazīmes, vai vismaz 30 zivju paraugus laboratoriskiem izmeklējumiem, ja klīniskas vai post mortem pazīmes nav novērotas;

218.4.2. līdz aizsardzības zonas atcelšanai audzētavā, kurā šo noteikumu 218.4.1. apakšpunktā minētajos laboratoriskajos izmeklējumos ir iegūti negatīvi rezultāti, reizi mēnesī organizē veselības pārbaudi;

218.5. visas audzētavas, kuras ir oficiāli deklarētas par inficētām ar infekciozo lašu anēmiju (bez IPR) vai kurās apstiprināta infekciozās lašu anēmijas klātbūtne, iztukšo, iztīra, dezinficē un tajās ievēro ne mazāk kā trīs mēnešus ilgu neizmantošanas periodu. Kad visas audzētavas aizsardzības zonā ir iztukšotas, iztīrītas, dezinficētas un ir beidzies ne mazāk kā sešas nedēļas ilgs sinhronizēts neizmantošanas periods, prasību par aizsardzības zonu un uzraudzības zonu var atcelt;

218.6. pēc neizmantošanas perioda beigām oficiāli deklarētajās inficētajās audzētavās aizsardzības zonas pārveido par uzraudzības zonām;

218.7. dienests izveidotās aizsardzības un uzraudzības zonas robežās, ja tiek novēroti infekcijas slimības turpmāki uzliesmojumi citās līdz šim neinficētās audzētavās, var noteikt arī citu audzētavu iztukšošanu, iztīrīšanu, dezinficēšanu un neizmantošanu. Neizmantošanas perioda ilgumu šajās audzētavās dienests nosaka, izvērtējot audzētavu inficēšanās risku katrā gadījumā atsevišķi, bet neizmantošanas periods ir ne mazāk kā trīs mēnešus ilgs;

218.8. audzētavās, kuras oficiāli deklarētas par inficētām ar infekciozās lašu anēmijas vīrusu ar infekciozās lašu anēmijas genotipu (bez IPR) vai kurās apstiprināta infekciozās lašu anēmijas klātbūtne, un visās citās aizsardzības un uzraudzības zonās esošajās audzētavās, kurās beidzies neizmantošanas periods, krājumus atjauno ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņa, kam noteikta I kategorija attiecībā uz infekciozo lašu anēmiju;

218.9. zivju krājumus atjauno pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods;

218.10. visās audzētavās un, ja nepieciešama savvaļas ūdensdzīvnieku populāciju uzraudzība, arī paraugu ņemšanas punktos, kas izraudzīti saskaņā ar šo noteikumu 215. punktu, pēc apkarošanas programmas pabeigšanas īsteno šo noteikumu 217. punktā minēto uzraudzības programmu.

219. Kontinentālā iecirknī, kas sastāv tikai no vienas audzētavas, kurā veselības stāvokli neietekmē apkārt esošie dabiskie ūdeņi un kurā saskaņā ar šo noteikumu 101. punktu ir atcelta I kategorija attiecībā uz infekciozo lašu anēmiju, dienests to var atjaunot, ja ir izpildīti šādi nosacījumi:

219.1. iecirknis ir iztukšots, iztīrīts, dezinficēts un ir beidzies ne mazāk kā sešas nedēļas ilgs neizmantošanas periods;

219.2. iecirknī krājumi ir atjaunoti ar zivīm, kas iegūtas no Latvijas valsts teritorijas, zonas vai iecirkņa, kurā attiecībā uz infekciozo lašu anēmiju ir noteikta I kategorija.

220. Ja I kategorijas saglabāšanai ir nepieciešama mērķtiecīga uzraudzība, visās audzētavās, kurās Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, organizē veselības pārbaudes un ņem zivju paraugus, kā noteikts šo noteikumu 9. pielikuma 3.B tabulā, atkarībā no audzētavas riska pakāpes attiecībā uz inficēšanos ar infekciozo lašu anēmiju.

221. Iecirknī, kam noteikta I kategorija un kas atrodas kontinentālā teritorijā, risks inficēties ar infekciozo lašu anēmiju uzskatāms par augstu, ja veselības stāvoklis attiecībā uz infekciozo lašu anēmiju šajā iecirknī ir atkarīgs no veselības stāvokļa apkārtējos dabiskajos ūdeņos, kur dzīvo Atlantijas lasis (Salmo salar). Šo vērtējumu ņem vērā, minētajos iecirkņos nosakot veselības pārbaužu biežumu.

222. I kategoriju attiecībā uz infekciozo lašu anēmiju saglabā līdz brīdim, kamēr par visiem paraugiem, kas laboratoriski izmeklēti, izmantojot šo noteikumu 9. pielikuma 3., 4. un 5. punktā norādītās diagnostikas metodes, attiecībā uz infekciozās lašu anēmijas vīrusu ar infekciozās lašu anēmijas genotipu (bez IPR) ir iegūti negatīvi rezultāti un izslēgtas jebkuras aizdomas par infekciozo lašu anēmiju šo noteikumu 9. pielikuma 6. punktā noteiktajā kārtībā.

223. Latvijas valsts teritorija, zona vai iecirknis, kurā attiecībā uz infekciozo lašu anēmiju ir noteikta V kategorija, var iegūt III kategoriju, ja:

223.1. ir izpildītas šo noteikumu 218.1., 218.2., 218.3., 218.4., 218.5., 218.6. un 218.7. apakšpunktā minētās prasības. Ja tehnisku iemeslu dēļ nav iespējams ievērot neizmantošanas periodu, valsts teritorijā, zonā vai iecirknī esošajās audzētavās īsteno kādu alternatīvu pasākumu, kas nodrošina līdzvērtīgu infekciozās lašu anēmijas vīrusa iznīcināšanu audzētavas vidē;

223.2. oficiāli deklarētajās inficētajās audzētavās un visās citās audzētavās, kuras atrodas izveidotajās aizsardzības un uzraudzības zonās un kurās ir beidzies neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 223.1. apakšpunktu, krājumi ir atjaunoti ar zivīm, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam noteikta I, II vai III kategorija attiecībā uz infekciozo lašu anēmiju;

223.3. zivju krājumi ir atjaunoti tikai pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un ir beidzies neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 223.1. apakšpunktu;

223.4. divu gadu laikā pēc 223.1., 223.2. un 223.3. apakšpunktā minēto pasākumu īstenošanas šajās audzētavās nav apstiprināts infekciozās lašu anēmijas vīruss ar infekciozās lašu anēmijas genotipu (bez IPR) un aizdomas par to tikušas izslēgtas šo noteikumu 9. pielikuma 6. punktā noteiktajā kārtībā.

XXII. Prasības marteiliozes (Marteilia refringens) uzraudzības un apkarošanas programmai, lai iegūtu un saglabātu akvakultūras dzīvnieku veselības stāvokli "infekcijas slimības neskarts" un ierobežotu inficēšanos ar Marteilia refringens

224. Marteiliozes uzraudzība ietver šādas darbības:

224.1. gliemeņu vispārīgu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 225. un 226. punktam;

224.2. gliemeņu specifisku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 227., 228., 229., 230., 231., 232., 233., 234., 235., 236. un 237. punktam, lai iegūtu I kategoriju – veselības stāvokli "infekcijas slimības neskarts";

224.3. gliemeņu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 238. un 239. punktam, lai saglabātu I kategoriju – veselības stāvokli "infekcijas slimības neskarts";

224.4. gliemeņu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 240. punktam, lai atceltu ierobežošanas pasākumus un Latvijas valsts teritorijai, zonai vai iecirknim, kam attiecībā uz marteiliozi piešķirta V kategorija, varētu piešķirt III kategoriju.

225. Veselības pārbaudes organizē un paraugus laboratoriskiem izmeklējumiem ņem sezonā, kad Marteilia refringens izplatība Latvijas valsts teritorijā, zonā vai iecirknī ir maksimāla. Ja šādu ziņu nav, paraugus ņem pēc tam, kad ūdens temperatūra ir pārsniegusi 17 °C.

226. Gliemeņu paraugus veselības pārbaudēm ņem atbilstoši šādiem kritērijiem:

226.1. ja ražošanas vienībās vai ražošanas teritorijā atrodas Ostrea spp. vai Mytilus spp., no abām ģintīm ņem pēc apjoma vienādus paraugus. Ja ir tikai viena no šīm ģintīm, paraugu ņem no tās. Ja nav nevienas minētās ģints pārstāvju, veido paraugu no visām citām pārstāvētajām uzņēmīgajām sugām;

226.2. ja sastopamas novājinātas, atvērušās vai nesen nobeigušās, bet nesadalījušās gliemenes, ievāc nesen nobeigušās gliemenes. Ja šādu gliemeņu nav, paraugam ņem vecākās veselīgās gliemenes;

226.3. no gliemeņu audzēšanas zonas, kurā izmanto vairāk nekā vienu ūdensapgādes avotu, gliemenes ņem no visiem ūdensapgādes avotiem tā, lai paraugā ir proporcionāli pārstāvētas visas audzēšanas zonas daļas;

226.4. gliemeņu audzēšanas zonā gliemenes no pietiekami daudziem paraugu ņemšanas punktiem ievāc tā, lai paraugā ir proporcionāli pārstāvētas visas gliemeņu audzēšanas zonas daļas. Paraugu ņemšanas punktus izraugās no tiem punktiem, kuros konstatēta Marteilia refringens, kā arī atkarībā no apdzīvotības blīvuma, ūdens plūsmām, uzņēmīgo sugu klātbūtnes, infekcijas slimības pārnesējsugu (turpmāk – vektorsugas) klātbūtnes, batimetrijas datiem un audzēšanas prakses. Paraugus ievāc arī dabiskajās gultnēs.

227. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz inficēšanos ar Marteilia refringens ir noteikta III kategorija, var iegūt I kategoriju, ja visās gliemeņu audzēšanas zonās, kurās valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas, ir īstenota uzraudzības programma.

228. Īstenojot divu gadu uzraudzības programmu:

228.1. gliemeņu audzēšanas zonās organizē veselības pārbaudes un ņem paraugus saskaņā ar šo noteikumu 10. pielikuma 4.A tabulu. Ja paraugā iekļauj Ostrea edulis, Mytilus edulis vai Mytilus galloprovincialis, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam noteikta I kategorija, tās gliemeņu audzēšanas zonā ir ielaistas ne vēlāk kā pavasarī tieši pirms uzraudzības programmas sākšanas;

228.2. visu paraugu laboratoriskiem izmeklējumiem izmanto šo noteikumu 10. pielikuma 2. punktā norādītās diagnostikas metodes, lai šo noteikumu 10. pielikuma 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par Marteilia refringens.

229. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz inficēšanos ar Marteilia refringens ir noteikta V kategorija, var iegūt I kategoriju, ja visās gliemeņu audzēšanas zonās, kurās Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, ir īstenoti šo noteikumu VI nodaļā minētie kontroles un apkarošanas pasākumi un gliemeņu audzēšanas zonas apkaimē, kas oficiāli deklarēta par inficētu ar Marteilia refringens, ir izveidota buferzona, kurā ietilpst aizsardzības zona un uzraudzības zona.

230. Buferzonu nosaka katrā inficēšanās gadījumā atsevišķi, ņemot vērā riska faktorus, kas ietekmē Marteilia refringens izplatīšanos:

230.1. ar Marteilia refringens inficētās gliemeņu audzēšanas zonas gliemeņu, arī savvaļas gliemeņu, mirstība (pēc skaita);

230.2. gliemeņu mirstība (pēc vecuma), mirstības rādītāji un sadalījums pa sugām un slimībām inficētajā audzētavā;

230.3. gliemeņu audzēšanas zonas attālums līdz apkaimes gliemeņu audzēšanas zonām un to izvietojuma blīvums, kā arī gliemeņu audzēšanas zonā atrodamās savvaļas gliemeņu sugas;

230.4. attālums līdz tuvākajam pārstrādes uzņēmumam;

230.5. attālums līdz saskarē esošām gliemeņu audzēšanas zonām;

230.6. uzņēmīgo sugu un vektorsugu klātbūtne gliemeņu audzēšanas zonā;

230.7. infekcijas slimības skartajās gliemeņu audzēšanas zonās un to apkaimē;

230.8. gliemeņu audzēšanas zonā izmantotā audzēšanas prakse;

230.9. hidrodinamiskie apstākļi;

230.10. citi epizootoloģiski nozīmīgi faktori.

231. Aizsardzības zonu un uzraudzības zonu izveido šādā kārtībā:

231.1. ap oficiāli deklarētu inficētu gliemeņu audzēšanas zonu, kurā konstatēta Marteilia refringens, izveido aizsardzības zonu, kas atbilst teritorijai, kuru nosaka, pamatojoties uz attiecīgajiem hidrodinamiskajiem vai epizootoloģiskajiem datiem;

231.2. ap aizsardzības zonu izveido uzraudzības zonu, kas atbilst teritorijai, kuru nosaka, pamatojoties uz attiecīgajiem hidrodinamiskajiem vai epizootoloģiskajiem datiem.

232. Īstenojot apkarošanas programmu:

232.1. aizsardzības zonā esošajā gliemeņu audzēšanas zonā, kurā tiek turētas uzņēmīgās akvakultūras dzīvnieku sugas un kura nav oficiāli deklarēta par inficētu ar Marteilia refringens, veic oficiālu izmeklēšanu, pēc Marteilia refringens izplatības perioda sākuma ņemot paraugus 150 gliemeņu laboratoriskiem izmeklējumiem. Ja Marteilia refringens izplatības periods nav zināms, paraugus sāk ņemt sezonā, kad ūdens temperatūra ir pārsniegusi 17 °C;

232.2. visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas iztukšo, ja iespējams, iztīra, dezinficē un ievēro to neizmantošanas periodu:

232.2.1. ne mazāk kā divus mēnešus, ja gliemeņu audzēšanas zona ir ierobežoti savienota ar ūdeņiem, kuros atrodas ikru inkubatori un mazuļu audzētavas;

232.2.2. ne mazāk kā divus mēnešus, ja gliemeņu audzēšanas zona ir neierobežoti savienota ar apkārtējiem ūdeņiem un uzņēmīgo sugu inficētās gliemenes un tādas uzņēmīgo sugu gliemenes, kas ir epizootoloģiski saistītas ar inficēto gliemeņu audzēšanas zonu, ir ievāktas vai aizvāktas, pirms iestājies maksimālās Marteilia refringens izplatības periods vai, ja tas nav zināms, sezona, kad ūdens temperatūra pārsniedz 17 °C;

232.2.3. ne mazāk kā 14 mēnešus, ja gliemeņu audzēšanas zona ir neierobežoti savienota ar apkārtējiem ūdeņiem un uzņēmīgo sugu inficētās gliemenes un tādas uzņēmīgo sugu gliemenes, kas ir epizootoloģiski saistītas ar inficēto gliemeņu audzēšanas zonu, nav ievāktas vai aizvāktas, pirms iestājies maksimālās Marteilia refringens izplatības periods vai, ja tas nav zināms, sezona, kad ūdens temperatūra pārsniedz 17 °C.

233. Kad visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas ir iztukšotas, ievēro četras nedēļas ilgu sinhronizētas neizmantošanas periodu.

234. Dienests izveidotās aizsardzības un uzraudzības zonas robežās esošajās gliemeņu audzēšanas zonās, ņemot vērā infekcijas slimības izplatīšanās riskus, kā arī to, ka no inficētās gliemeņu audzēšanas zonas ir notikusi gliemeņu pārvietošana, var noteikt arī citu gliemeņu audzēšanas zonu iztukšošanu, iztīrīšanu, dezinficēšanu un neizmantošanu, ja epizootoloģisko pētījumu rezultātā ir konstatēta gliemeņu ievešana no inficētās gliemeņu audzēšanas zonas. Neizmantošanas perioda ilgumu dienests nosaka, izvērtējot inficēšanās risku katrā gadījumā atsevišķi, bet tas nedrīkst būt ilgāks par četrām nedēļām.

235. Visās oficiāli deklarētajās inficētajās gliemeņu audzēšanas zonās un visās citās vietās, kas atrodas izveidotajās aizsardzības un uzraudzības zonās, ja ir beidzies to neizmantošanas periods, krājumus atjauno ar gliemenēm, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam noteikta I kategorija attiecībā uz inficēšanos ar Marteilia refringens.

236. Gliemeņu krājumus atjauno tikai pēc tam, kad visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas saskaņā ar šo noteikumu 232.2. un 232.3. apakšpunktu ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods.

237. Visās gliemeņu audzēšanas zonās, kurās apkarošanas programmas aptvertajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, pēc apkarošanas pasākumu pabeigšanas īsteno šo noteikumu 63. punktā minēto uzraudzības programmu.

238. I kategoriju – veselības stāvoklis "infekcijas slimības neskarts" – saglabā, ja, īstenojot mērķtiecīgu uzraudzību, visās gliemeņu audzēšanas zonās, kas Latvijas valsts teritorijā, zonā vai iecirknī tur uzņēmīgās akvakultūras dzīvnieku sugas, organizē veselības pārbaudes atkarībā no inficēšanās riska pakāpes gliemeņu audzēšanas zonā un ņem paraugus, kā noteikts šo noteikumu 10. pielikuma 4.B tabulā.

239. I kategoriju saglabā līdz brīdim, kamēr par visiem paraugiem, kas laboratoriski izmeklēti, izmantojot šo noteikumu 10. pielikuma 2. punktā norādītās diagnostikas metodes, attiecībā uz Marteilia refringens ir iegūti negatīvi rezultāti un šo noteikumu 10. pielikuma 3. punktā noteiktajā kārtībā izslēgtas jebkuras aizdomas par Marteilia refringens.

240. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz inficēšanos ar Marteilia refringens ir noteikta V kategorija, var iegūt III kategoriju, ja:

240.1. ir izpildītas šo noteikumu 229., 230., 231., 232., 233. un 234. punktā minētās prasības. Ja tehnisku iemeslu dēļ nav iespējams ievērot neizmantošanas periodu, attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī esošajā gliemeņu audzēšanas zonā īsteno kādu alternatīvu pasākumu, kas nodrošina līdzvērtīgu Marteilia refringens iznīcināšanu zonas vidē;

240.2. oficiāli deklarētajās inficētajās gliemeņu audzēšanas zonās un visās citās vietās, kuras atrodas aizsardzības un uzraudzības zonās un ir beidzies to neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 240.1. apakšpunktu, krājumi ir atjaunoti ar gliemenēm, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam attiecībā uz inficēšanos ar Marteilia refringens noteikta I, II vai III kategorija;

240.3. gliemeņu krājumi atjaunoti tikai pēc tam, kad visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 240.1. apakšpunktu;

240.4. divu gadu laikā pēc šo noteikumu 240.1., 240.2. un 240.3. apakšpunktā minēto pasākumu īstenošanas nav apstiprināta inficēšanās ar Marteilia refringens un šo noteikumu 10. pielikuma 3. punktā noteiktajā kārtībā izslēgtas aizdomas par inficēšanos.

XXIII. Prasības bonamiozes (Bonamia ostreae) uzraudzības un apkarošanas programmai, lai iegūtu un saglabātu akvakultūras dzīvnieku veselības stāvokli "infekcijas slimības neskarts" un ierobežotu inficēšanos ar Bonamia ostreae

241. Bonamiozes uzraudzība ietver šādas darbības:

241.1. gliemeņu vispārīgu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 242. un 243. punktam;

241.2. gliemeņu specifisku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 244., 245., 246., 247., 248., 249., 250., 251., 252., 253. un 254. punktam, lai iegūtu I kategoriju – veselības stāvoklis "infekcijas slimības neskarts";

241.3. gliemeņu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 255., 256. un 257. punktam, lai saglabātu I kategoriju – veselības stāvoklis "infekcijas slimības neskarts".

242. Gliemeņu vispārīgās veselības pārbaudes organizē un paraugus ņem tajā sezonā, kad Bonamia ostreae izplatība Latvijas valsts teritorijā, zonā vai iecirknī ir maksimāla. Ja Bonamia ostreae izplatība nav zināma, paraugus ņem ziemā vai pavasara sākumā.

243. Gliemeņu paraugus veselības pārbaudēm ņem atbilstoši šādiem kritērijiem:

243.1. ja ir sastopama Ostrea edulis, paraugam ņem tikai šīs sugas gliemenes. Ja Ostrea edulis nav, veido paraugu no visām citām pārstāvētajām uzņēmīgajām sugām;

243.2. ja sastopamas novājinātas, atvērušās vai nobeigušās, bet nesadalījušās gliemenes, ievāc nesen nobeigušās gliemenes. Ja šādu gliemeņu nav, paraugam ņem vecākās veselīgākās gliemenes;

243.3. no gliemeņu audzēšanas zonas, kurā izmanto vairāk nekā vienu ūdensapgādes avotu, gliemenes ņem no visiem ūdensapgādes avotiem tā, lai paraugā ir proporcionāli pārstāvētas visas gliemeņu audzēšanas zonas daļas;

243.4. gliemeņu audzēšanas zonā gliemenes ievāc no pietiekami daudziem paraugu ņemšanas punktiem. Paraugu ņemšanas punktus izraugās no tiem punktiem, kuros konstatēta Bonamia ostreae, kā arī atkarībā no apdzīvotības blīvuma, ūdens plūsmas, uzņēmīgo sugu klātbūtnes, vektorsugu klātbūtnes, batimetrijas datiem un audzēšanas prakses. Paraugus ievāc arī blakus esošajās dabiskajās gultnēs.

244. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz Bonamia ostreae ir noteikta III kategorija, var iegūt I kategoriju, ja visās gliemeņu audzēšanas zonās, kurās Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, ir īstenota uzraudzības programma.

245. Īstenojot divu gadu uzraudzības programmu:

245.1. gliemeņu audzēšanas zonās organizē veselības pārbaudes un ņem paraugus, kā noteikts šo noteikumu 9. pielikuma 5.A tabulā. Ja paraugā iekļauj Ostrea edulis, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam noteikta I kategorija, tās gliemeņu audzēšanas zonā ir ielaistas ne vēlāk kā rudenī tieši pirms uzraudzības programmas sākšanas;

245.2. visu paraugu laboratoriskiem izmeklējumiem izmanto šo noteikumu 11. pielikuma 2. punktā norādītās diagnostikas metodes, lai šo noteikumu 11. pielikuma 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par Bonamia ostreae.

246. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz inficēšanos ar Bonamia ostreae ir noteikta V kategorija, var iegūt I kategoriju, ja visās gliemeņu audzēšanas zonās, kurās Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, ir īstenota apkarošanas programma un šo noteikumu VI nodaļā minētie kontroles un apkarošanas pasākumi pēc eksotisko infekcijas slimību konstatēšanas akvakultūras dzīvniekiem, kā arī gliemeņu audzēšanas zonas apkaimē, kas oficiāli deklarēta par inficētu ar Bonamia ostreae, ir izveidota buferzona, kurā ietilpst aizsardzības zona un uzraudzības zona.

247. Buferzonu nosaka katrā inficēšanās gadījumā atsevišķi, ņemot vērā riska faktorus, kas ietekmē Bonamia ostreae izplatīšanos:

247.1. ar Bonamia ostreae inficētās gliemeņu audzēšanas zonas gliemeņu, arī savvaļas gliemeņu, mirstība pēc skaita, mirstības rādītāji, raksturojums pēc vecuma un sadalījuma pa sugām un slimībām inficētajā audzētavā;

247.2. attālums līdz apkaimes gliemeņu audzēšanas zonām un to izvietojuma blīvums, kā arī gliemeņu audzēšanas zonā atrodamās savvaļas gliemeņu sugas;

247.3. attālums līdz tuvākajam pārstrādes uzņēmumam;

247.4. attālums līdz saskarē esošām gliemeņu audzēšanas zonām;

247.5. uzņēmīgo sugu un vektorsugu klātbūtne gliemeņu audzēšanas zonā;

247.6. Bonamia ostreae skartajās gliemeņu audzēšanas zonās un to apkaimes gliemeņu audzēšanas zonās izmantotā audzēšanas prakse;

247.7. hidrodinamiskie apstākļi;

247.8. citi epizootoloģiski nozīmīgi faktori.

248. Aizsardzības zonu un uzraudzības zonu izveido šādā kārtībā:

248.1. ap oficiāli deklarētu inficētu gliemeņu audzēšanas zonu, kurā konstatēta Bonamia ostreae, izveido aizsardzības zonu, kas atbilst teritorijai, kuru nosaka, pamatojoties uz hidrodinamiskajiem vai epizootoloģiskajiem datiem;

248.2. ap aizsardzības zonu izveido uzraudzības zonu, kas atbilst teritorijai, kuru nosaka, pamatojoties uz hidrodinamiskajiem vai epizootoloģiskajiem datiem.

249. Aizsardzības zonā esošajā gliemeņu audzēšanas zonā, kurā tiek turētas uzņēmīgās sugas un kura nav oficiāli deklarēta par inficētu ar Bonamia ostreae, veic oficiālu izmeklēšanu, pēc Bonamia ostreae izplatības perioda sākuma ņemot paraugus 150 uzņēmīgu sugu gliemeņu laboratoriskiem izmeklējumiem. Ja Bonamia ostreae izplatības periods nav zināms, paraugus sāk ņemt ziemā vai pavasara sākumā.

250. Visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas, kurās konstatēta Bonamia ostreae, iztukšo, ja iespējams, iztīra, dezinficē un ievēro sešus mēnešus ilgu neizmantošanas periodu.

251. Kad visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas ir iztukšotas, ievēro četras nedēļas ilgu sinhronizētu neizmantošanas periodu.

252. Dienests izveidotajās aizsardzības un uzraudzības zonās vai gliemeņu audzēšanas zonās var pieprasīt veikt arī citu gliemeņu audzēšanas zonu iztukšošanu, iztīrīšanu, dezinficēšanu un neizmantošanu. Neizmantošanas perioda ilgumu dienests nosaka, izvērtējot inficēšanās risku katrā gadījumā atsevišķi.

253. Visās oficiāli deklarētajās inficētajās gliemeņu audzēšanas zonās un visās citās vietās, kas atrodas izveidotajās aizsardzības un uzraudzības zonās, ja ir beidzies to neizmantošanas periods, krājumus atjauno ar gliemenēm, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam noteikta I kategorija attiecībā uz inficēšanos ar Bonamia ostreae. Krājumus atjauno tikai pēc tam, kad visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas saskaņā ar šo noteikumu 250., 251. un 252. punktu ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods.

254. Visās gliemeņu audzēšanas zonās, kurās apkarošanas programmas aptvertajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, pēc apkarošanas pasākumu pabeigšanas īsteno šo noteikumu 244. un 245. punktā minēto uzraudzības programmu.

255. Ja I kategorijas saglabāšanai attiecībā uz inficēšanos ar Bonamia ostreae ir nepieciešama mērķtiecīga uzraudzība, visās gliemeņu audzēšanas zonās, kurās Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, organizē veselības pārbaudes atkarībā riska pakāpes attiecībā uz inficēšanos ar Bonamia ostreae un ņem paraugus, kā noteikts šo noteikumu 11. pielikuma 5.B tabulā.

256. I kategoriju saglabā līdz brīdim, kamēr par visiem paraugiem, kas laboratoriski izmeklēti, izmantojot šo noteikumu 11. pielikuma 2. punktā norādītās diagnostikas metodes, attiecībā uz Bonamia ostreae ir iegūti negatīvi rezultāti un šo noteikumu 11. pielikuma 3. punktā noteiktajā kārtībā izslēgtas jebkuras aizdomas par Bonamia ostreae.

257. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz inficēšanos ar Bonamia ostreae ir noteikta V kategorija, var iegūt III kategoriju, ja:

257.1. ir izpildītas šo noteikumu 246., 247., 248., 249., 250., 251., 252. un 253. punktā noteiktās prasības. Ja tehnisku iemeslu dēļ nav iespējams ievērot neizmantošanas periodu, attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī esošajā gliemeņu audzēšanas zonā īsteno kādu alternatīvu pasākumu, kas nodrošina līdzvērtīgu efektu Bonamia ostreae iznīcināšanai zonas teritorijā;

257.2. oficiāli deklarētajās inficētajās gliemeņu audzēšanas zonās un visās citās vietās, kuras atrodas izveidotajās aizsardzības un uzraudzības zonās un ir beidzies to neizmantošanas periods vai saskaņā ar šo noteikumu 257.1. apakšpunktu īstenoti alternatīvi pasākumi, krājumi ir atjaunoti ar gliemenēm, kas iegūtas Latvijas valsts teritorijā, zonā vai iecirknī, kam attiecībā uz inficēšanos ar Bonamia ostreae noteikta I, II vai III kategorija;

257.3. gliemeņu krājumi atjaunoti tikai pēc tam, kad visas oficiāli deklarētās inficētās gliemeņu audzēšanas zonas ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods vai īstenoti alternatīvi pasākumi saskaņā ar šo noteikumu 257.1. apakšpunktu;

257.4. divu gadu laikā pēc 257.1., 257.2. un 257.3. apakšpunktā minēto pasākumu īstenošanas nav apstiprināta inficēšanās ar Bonamia ostreae un šo noteikumu 11. pielikuma 3. punktā noteiktajā kārtībā izslēgtas jebkuras aizdomas par inficēšanos.

XXIV. Prasības vēžu baltplankumu slimības uzraudzības un apkarošanas programmai, lai iegūtu un saglabātu akvakultūras dzīvnieku veselības stāvokli "infekcijas slimības neskarts" un ierobežotu inficēšanos ar baltplankumu sindroma vīrusa 1. tipu

258. Vēžu baltplankumu slimības uzraudzība ietver šādas darbības:

258.1. vēžveidīgo vispārīgu veselības pārbaužu organizēšanu atbilstoši šo noteikumu 259., 260., 261. un 262. punktam;

258.2. vēžveidīgo specifisku veselības pārbaužu organizēšanu atbilstoši šo noteikumu 263., 264., 265., 266., 267., 268., 269., 270., 271., 272., 273., 274., 275. un 276. punktam, lai iegūtu I kategoriju – veselības stāvoklis "infekcijas slimības neskarts";

258.3. vēžveidīgo veselības pārbaužu organizēšanu atbilstoši šo noteikumu 277., 278., 279. un 280. punktam, lai saglabātu I kategoriju – veselības stāvoklis "infekcijas slimības neskarts";

258.4. vēžveidīgo veselības pārbaužu organizēšanu atbilstoši šo noteikumu 281. punktam, lai atceltu ierobežošanas pasākumus un Latvijas valsts teritorijai, zonai vai iecirknim, kam attiecībā uz vēžu baltplankumu slimību noteikta V kategorija, varētu piešķirt III kategoriju.

259. Vēžveidīgo vispārīgās veselības pārbaudes organizē un paraugus laboratoriskiem izmeklējumiem ņem tad, kad varētu būt sasniegta gada augstākā ūdens temperatūra.

260. Audzētavās vēžveidīgo paraugus ņem atbilstoši šādiem kritērijiem:

260.1. ja ražošanas vienībās ir novājināti vai mirstoši vēžveidīgie, ņem novājinātus vēžveidīgos. Ja šādu vēžveidīgo nav, paraugam ņem pie izraudzītajām uzņēmīgajām sugām piederošus un proporcionāli pārstāvētus dažāda lieluma vēžveidīgos – gan jaunuļus, gan pieaugušos indivīdus;

260.2. ja vēžveidīgo audzēšanai izmanto vairāk nekā vienu ūdensapgādes avotu, paraugus ņem no visiem ūdensapgādes avotiem.

261. Ja saskaņā ar šo noteikumu 103.3. apakšpunktu ir nepieciešama mērķtiecīga savvaļas ūdensdzīvnieku populācijas uzraudzība, paraugu ņemšanas punktu skaitu un ģeogrāfisko sadalījumu nosaka tā, lai būtu aptverta attiecīgā Latvijas valsts teritorija, zona vai iecirknis. Paraugu ņemšanas punkti pārstāv dažādas ekosistēmas – jūras, grīvu, upju un ezeru sistēmu, kurā atrodas uzņēmīgo sugu savvaļas ūdensdzīvnieku populācijas.

262. Ja saskaņā ar šo noteikumu 103.2. apakšpunktu ir nepieciešama mērķtiecīga savvaļas ūdensdzīvnieku populācijas uzraudzība, vēžveidīgos paraugam izraugās šādi:

262.1. jūras un grīvu sistēmu teritorijās izraugās vienu vai vairākas no šādām sugām – Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus – vai tīģergarneļu sugas, piemēram, Penaeus japonicus, Penaeus kerathurus, Penaeus semisulcatus. Ja minēto sugu nav, paraugā ir pārstāvētas citas uzņēmīgās desmitkājvēžu sugas. Tā kā uzņēmīgo saimniekorganismu klāsts ir plašs, tos var izraudzīties no tādām desmitkājvēžu ģintīm vai dzimtām, kuru uzņēmība ir eksperimentāli vai dabiski pierādīta;

262.2. upju un ezeru sistēmās izraugās vienu vai vairākas no tādām sugām kā Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes vai Orconectes limosus. Ja minēto sugu nav, paraugā ir pārstāvētas citas uzņēmīgās desmitkājvēžu sugas. Tā kā uzņēmīgo saimniekorganismu klāsts ir plašs, tos var izraudzīties no tādām desmitkājvēžu ģintīm vai dzimtām, kuru uzņēmība ir eksperimentāli vai dabiski pierādīta;

262.3. ja vēžveidīgo vidū ir novājināti vai mirstoši vēžveidīgie, ņem novājinātus vēzveidīgos. Ja šādu vēžveidīgo nav, paraugam ņem pie izraudzītajām uzņēmīgajām sugām piederošus un proporcionāli pārstāvētus dažāda lieluma vēžveidīgos – gan jaunuļus, gan pieaugušos indivīdus.

263. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz vēžu baltplankumu slimību ir noteikta III kategorija, var iegūt I kategoriju, ja attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī esošās audzētavas, kurās tiek turētas uzņēmīgās sugas:

263.1. atbilst šo noteikumu XIV nodaļā minētajām prasībām;

263.2. saskaņā ar šo noteikumu 103.3. apakšpunktu īsteno divu gadu uzraudzības programmu, kas attiecas arī uz paraugu ņemšanas punktiem savvaļas ūdensdzīvnieku populācijā (ja tādi nepieciešami).

264. Īstenojot uzraudzības programmu, audzētavās vai paraugu ņemšanas punktos divus gadus pēc kārtas:

264.1. organizē veselības pārbaudes un ņem paraugus, kā noteikts šo noteikumu 12. pielikuma 6.A tabulā;

264.2. paraugu laboratoriskiem izmeklējumiem izmanto šo noteikumu 10. pielikuma 2. punktā norādīto diagnostikas metodi, lai šo noteikumu 10. pielikuma 3. punktā noteiktajā kārtībā izslēgtu jebkuras aizdomas par vēžu baltplankumu slimību.

265. Ja uzraudzības programmas īstenošanas laikā kādā no audzētavām ir apstiprināta inficēšanās ar baltplankumu sindroma vīrusa 1. tipu un audzētavai atcelta II kategorija, audzētava to var atgūt un turpināt uzraudzības programmas īstenošanu, lai iegūtu I kategoriju, neīstenojot šo noteikumu 266. punktā minēto apkarošanas programmu, ja:

265.1. tā ir kontinentāla audzētava, kurā veselības stāvoklis attiecībā uz vēžu baltplankumu slimību saskaņā ar šo noteikumu 110., 111., 112., 113., 114., 115., 116., 117., 118., 119. un 120. punktu nav atkarīgs no veselības stāvokļa apkārtējos dabiskajos ūdeņos;

265.2. audzētava ir iztukšota, iztīrīta, dezinficēta un ir beidzies ne mazāk kā sešas nedēļas ilgs neizmantošanas periods;

265.3. audzētavas krājumi ir atjaunoti ar vēžveidīgajiem, kas iegūti Latvijas valsts teritorijā, zonā vai iecirknī, kam attiecībā uz vēžu baltplankumu slimību ir noteikta I kategorija.

266. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz vēžu baltplankumu slimību ir noteikta V kategorija, var iegūt I kategoriju, ja visās attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī esošajās audzētavās, kurās tiek turētas uzņēmīgās sugas, ir īstenota apkarošanas programma, izpildot šo noteikumu VII nodaļā minētos kontroles un apkarošanas pasākumus, un tās audzētavas apkaimē, kas oficiāli deklarēta par inficētu ar vēžu baltplankumu slimību, ir izveidota buferzona, kurā ietilpst aizsardzības zona un uzraudzības zona.

267. Buferzonu nosaka katrā inficēšanās gadījumā atsevišķi, ņemot vērā riska faktorus, kas ietekmē vēžu baltplankumu slimības izplatību audzētavas un savvaļas vēžveidīgo populācijā:

267.1. ar vēžu baltplankumu slimību inficētās audzētavas vēžveidīgo mirstība pēc skaita, mirstības rādītāji un sadalījums pa sugām un slimībām inficētajā audzētavā;

267.2. attālums līdz apkaimes audzētavām un to izvietojuma blīvums;

267.3. saskarē esošās audzētavas;

267.4. audzētavās pārstāvētās sugas;

267.5. slimības skartajās audzētavās un to apkaimes audzētavās izmantotā audzēšanas prakse;

267.6. hidrodinamiskie apstākļi;

267.7. citi epizootoloģiski nozīmīgi faktori.

268. Aizsardzības zonu un uzraudzības zonu izveido šādā kārtībā:

268.1. ap oficiāli deklarētu inficētu audzētavu, kurā konstatēta vēžu baltplankumu slimība, izveido aizsardzības zonu:

268.1.1. jūras un grīvas teritorijās – aplī norobežotu teritoriju, kuras rādiuss atbilst vienas plūdmaiņu joslas platumam vai ir pieci kilometri (izmanto lielāko vērtību) ar audzētavu centrā, vai līdzvērtīgu teritoriju, ko nosaka, pamatojoties uz hidrodinamiskajiem vai epizootoloģiskajiem datiem;

268.1.2. saldūdeņos – visu ūdens sateces teritoriju, kas atbilst audzētavai, kura ir oficiāli deklarēta par inficētu ar vēžu baltplankumu slimību. Dienests aizsardzības zonu var ierobežot tikai ar ūdens sateces teritorijas daļām, ja ar to netiek pasliktināta vēžu baltplankumu slimības izplatības profilakse;

268.2. ap aizsardzības zonu izveido uzraudzības zonu:

268.2.1. jūras teritorijās – teritoriju, kurā vērojama plūdmaiņu joslu zonu pārklāšanās, vai aplī norobežotu teritoriju 10 kilometru rādiusā no aizsardzības zonas centra, vai līdzvērtīgu teritoriju, ko nosaka, pamatojoties uz hidrodinamiskajiem vai epizootoloģiskajiem datiem;

268.2.2. saldūdeņos – paplašinātu teritoriju ārpus izveidotās aizsardzības zonas.

269. Aizsardzības zonas audzētavā, kurā tiek turētas uzņēmīgās sugas un kura nav oficiāli deklarēta par inficētu ar vēžu baltplankumu slimību, veic oficiālu izmeklēšanu:

269.1. laboratoriskiem izmeklējumiem ņem 10 vēžveidīgo paraugus, ja klīniski vai post mortem ir novērotas vēžu baltplankumu slimībai raksturīgās pazīmes, vai 150 vēžveidīgo paraugus, ja šādas pazīmes klīniski vai post mortem nav novērotas;

269.2. līdz aizsardzības zonas atcelšanai saskaņā ar šo noteikumu 270., 271. un 272. punktu audzētavā, kurā šo noteikumu 269.1. apakšpunktā minētajos laboratoriskajos izmeklējumos ir iegūti negatīvi rezultāti, reizi mēnesī organizē veselības pārbaudi.

270. Visas oficiāli deklarētās inficētās audzētavas, kurās konstatēta vēžu baltplankumu slimība, iztukšo, iztīra, dezinficē un ievēro ne mazāk kā sešas nedēļas ilgu neizmantošanas periodu. Kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, ievēro ne mazāk kā trīs nedēļas ilgu sinhronizētas neizmantošanas periodu.

271. Kad oficiāli deklarētajās inficētajās audzētavās ir pagājis neizmantošanas periods, aizsardzības zonas pārveido par uzraudzības zonām.

272. Dienests izveidotajās aizsardzības un uzraudzības zonās var pieprasīt iztukšot, iztīrīt, dezinficēt un neizmantot arī citas audzētavas. Neizmantošanas perioda ilgumu dienests nosaka, izvērtējot inficēšanās risku katrā gadījumā atsevišķi.

273. Oficiāli deklarētajās inficētajās audzētavās un visās citās audzētavās, kas atrodas izveidotajās aizsardzības un uzraudzības zonās, pēc neizmantošanas perioda krājumus atjauno vienā no šādiem veidiem:

273.1. ar vēžveidīgajiem, kas iegūti Latvijas valsts teritorijā, zonā vai iecirknī, kam attiecībā uz vēžu baltplankumu slimību ir noteikta I kategorija;

273.2. pārejas periodā līdz 2020. gada 31. decembrim – ar vēžveidīgajiem no Latvijas valsts teritorijas, zonas vai iecirkņa, kurā īsteno apstiprinātu vēžu baltplankumu slimības uzraudzības programmu.

274. Vēžveidīgo krājumus atjauno tikai pēc tam, kad visas oficiāli deklarētās inficētās audzētavas, kurās konstatēta vēžu baltplankumu slimība, saskaņā ar šo noteikumu 270., 271. un 272. punktu ir iztukšotas, iztīrītas, dezinficētas un ir beidzies to neizmantošanas periods.

275. Visās audzētavās, kurās apkarošanas programmas aptvertajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, un, ja nepieciešama savvaļas ūdensdzīvnieku populāciju uzraudzība, arī paraugu ņemšanas punktos, kas izraudzīti saskaņā ar šo noteikumu 103.2. apakšpunktu, pēc apkarošanas programmas pabeigšanas īsteno šo noteikumu 263. un 264. punktā minēto uzraudzības programmu.

276. Kontinentālā iecirknī, kas sastāv tikai no vienas audzētavas, kurā veselības stāvokli attiecībā uz vēžu baltplankumu slimību saskaņā ar šo noteikumu 110., 111., 112., 113., 114., 115., 116., 117., 118., 119. un 120. punktu neietekmē apkārt esošie dabiskie ūdeņi un kam I kategorija ir atcelta, dienests to var atjaunot, ja ir izpildīti šādi nosacījumi:

276.1. audzētava ir iztukšota, iztīrīta, dezinficēta un ir beidzies ne mazāk kā sešas nedēļas ilgs neizmantošanas periods;

276.2. audzētavas krājumi ir atjaunoti ar vēžveidīgajiem, kas iegūti Latvijas valsts teritorijā, zonā vai iecirknī, kam attiecībā uz vēžu baltplankumu slimību ir noteikta I kategorija.

277. Ja I kategorijas saglabāšanai ir nepieciešama mērķtiecīga uzraudzība, visās audzētavās, kurās attiecīgajā Latvijas valsts teritorijā, zonā vai iecirknī tiek turētas uzņēmīgās sugas, organizē veselības pārbaudi atkarībā no audzētavas riska pakāpes attiecībā uz inficēšanos ar vēžu baltplankumu slimību un ņem paraugus, kā noteikts šo noteikumu 12. pielikuma 6.B tabulā.

278. Ja Latvijas valsts teritorijā, zonā vai iecirknī audzētavu nav daudz un to mērķtiecīga uzraudzība nesniedz pietiekami daudz epizootoloģisko datu, lai iegūtu un saglabātu I kategoriju, uzraudzības programmu īsteno arī paraugu ņemšanas punktos, kas izraudzīti saskaņā ar šo noteikumu 261. un 262. punktu.

279. Katru gadu maina pusi šo noteikumu 280. punktā minēto paraugu ņemšanas punktu. Paraugus ņem, kā noteikts šo noteikumu 12. pielikuma 6.B tabulā, un laboratoriski izmeklē šo noteikumu 12. pielikumā noteiktajā kārtībā.

280. I kategoriju saglabā līdz brīdim, kamēr par visiem paraugiem, kas laboratoriski izmeklēti, izmantojot šo noteikumu 12. pielikuma 2. un 3. punktā norādītās diagnostikas metodes, ir iegūti negatīvi rezultāti un šo noteikumu 12. pielikuma 4. punktā noteiktajā kārtībā izslēgtas jebkuras aizdomas par vēžu baltplankumu slimību.

281. Latvijas valsts teritorija, zona vai iecirknis, kam attiecībā uz vēžu baltplankumu slimību ir noteikta V kategorija, var iegūt III kategoriju, ja:

281.1. ir izpildītas šo noteikumu 266., 267., 268., 269., 270., 271. un 272. punktā minētās prasības. Ja tehnisku iemeslu dēļ nav iespējams ievērot neizmantošanas periodu, Latvijas valsts teritorijā, zonā vai iecirknī esošajā audzētavā īsteno kādu alternatīvu pasākumu, kas nodrošina līdzvērtīgu baltplankumu sindroma vīrusa 1. tipa iznīcināšanu audzētavas vidē;

281.2. oficiāli deklarētajās inficētajās audzētavās un visās citās audzētavās, kuras atrodas izveidotajās aizsardzības un uzraudzības zonās un kurās ir beidzies neizmantošanas periods vai saskaņā ar šo noteikumu 281.1. apakšpunktu īstenoti alternatīvi pasākumi, krājumi ir atjaunoti ar vēžveidīgajiem, kas iegūti Latvijas valsts teritorijā, zonā vai iecirknī, kam noteikta I, II vai III kategorija attiecībā uz vēžu baltplankumu slimību;

281.3. krājumi atjaunoti pēc tam, kad visas oficiāli deklarētās inficētās audzētavas ir iztukšotas, iztīrītas, dezinficētas un beidzies to neizmantošanas periods vai saskaņā ar šo noteikumu 281.1. apakšpunktu īstenoti alternatīvi pasākumi;

281.4. divu gadu laikā pēc šo noteikumu 281.1. un 281.2. apakšpunktā minēto pasākumu īstenošanas vēžu baltplankumu slimība nav konstatēta un šo noteikumu 12. pielikuma 4. punktā noteiktajā kārtībā ir izslēgtas jebkuras aizdomas par to.

XXV. Noslēguma jautājums

282. Atzīt par spēku zaudējušiem Ministru kabineta 2008. gada 2. jūnija noteikumus Nr. 400 "Veterinārās prasības akvakultūras dzīvniekiem, no tiem iegūtiem produktiem un to apritei, kā arī atsevišķu akvakultūras dzīvnieku infekcijas slimību profilaksei un apkarošanai" (Latvijas Vēstnesis, 2008, 88. nr.; 2009, 166. nr.; 2013, 23.; 2014, 113. nr.).

Informatīva atsauce uz Eiropas Savienības direktīvām

Noteikumos iekļautas tiesību normas, kas izriet no:

1) Padomes 2006. gada 24. oktobra Direktīvas 2006/88/EK par akvakultūras dzīvniekiem un to produktiem izvirzītajām dzīvnieku veselības prasībām, kā arī par konkrētu ūdensdzīvnieku slimību profilaksi un kontroli;

2) Komisijas 2008. gada 30. aprīļa Direktīvas 2008/53/EK, ar ko groza Padomes Direktīvas 2006/88/EK IV pielikumu attiecībā uz karpu pavasara virēmiju;

3) Komisijas 2012. gada 25. oktobra īstenošanas Direktīvas 2012/31/ES, ar kuru groza Padomes Direktīvas 2006/88/EK IV pielikumu attiecībā uz to zivju sugu sarakstu, kas ir uzņēmīgas pret virusālo hemorāģisko septicēmiju, un ieraksta par epizootisko čūlu sindromu svītrošanu;

4) Komisijas 2014. gada 13. februāra Īstenošanas direktīvas 2014/22/ES, ar ko groza Padomes Direktīvas 2006/88/EK IV pielikumu attiecībā uz lašu infekciozo anēmiju.

Ministru prezidenta vietā –
zemkopības ministrs Jānis Dūklavs

Iekšlietu ministrs Rihards Kozlovskis

 

1. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Akvakultūras dzīvnieku infekcijas slimības

I. Eksotiskās infekcijas slimības

Nr.
p.k.

Infekcijas slimība

Uzņēmīgās akvakultūras dzīvnieku sugas nosaukums latviešu valodā un latīņu valodā

Zivju infekcijas slimības

1. Epizootiskā hematopoētiskā nekroze Varavīksnes forele (Oncorhynchus mykiss),

asaris (Perca fluviatilis)

Divvāku molusku infekcijas slimības

2. Bonamioze Austrālijas dubļu austere (Ostrea angasi),

Čīles plakanā austere (Ostera chilensis)

3. Perkinsoze Karaliskā Klusā okeāna austere (Crassostrea gigas),

Austrumu austere (Crassostrea virginica)

4. Mikrocitoze Karaliskā Klusā okeāna austere (Crassostrea gigas),

Austrumu austere (Crassostrea virginica),

Olimpijas plakanā austere (Ostrea conchaphila),

Eiropas plakanā jeb īstā (dabiskā) austere (Ostrea edulis)

Vēžveidīgo infekcijas slimības

5. Taura sindroms Atlantijas baltā garnele (Penaeus setiferus),

zilā garnele (Penaeus stylirostris),

baltā garnele (Penaeus vannamei)

6. Dzeltenās galvas slimība Ziemeļu brūnā garnele (Penaeus aztecus),

Ziemeļu rozā garnele (Penaeus duorarum),

kuruma garnele (Penaeus japonicus),

lielā tīģergarnele (Penaeus monodon),

Atlantijas baltā garnele (Penaeus setiferus),

zilā garnele (Penaeus stylirostris),

baltā garnele (Penaeus vannamei)

II. Neeksotiskās infekcijas slimības

Nr.
p.k.

Infekcijas slimība

Uzņēmīgās akvakultūras dzīvnieku sugas nosaukums latviešu valodā un latīņu valodā

Zivju infekcijas slimības

7. Virālā hemorāģiskā septicēmija Siļķu ģints (Clupea spp.), sīgu ģints (Coregonus sp.),

līdaka (Esox lucius), pikša (Gadus aeglefinus),

Klusā okeāna menca (Gadus macrocephalus),

Atlantijas menca (Gadus morhua), Klusā okeāna lasis (Oncorhynchus spp.), varavīksnes forele (Oncorhynchus mykiss), ūsainā jūras vēdzele (Onos mustelus),

taimiņš (Salmo trutta), akmeņplekste (Scophtalmus maximus), brētliņa (Sprattus sprattus),

plekste (Paralichthys olivaceus)

8. Infekciozā hematopoētiskā nekroze Ketlasis (Oncorhynchus keta), kižučs (Oncorhynchus kisutch), Tālo Austrumu lasis (Oncorhynchus masou), varavīksnes forele (Oncorhynchus mykiss), nerka (Oncorhynchus nerka), amago lasis (Oncorhynchus rhodurus), čaviča (Oncorhynchus tshawytscha),

Atlantijas lasis (Salmo salar)

9. Koi herpes vīruss Sazāns (Cyprinus carpio)
10. Infekciozā lašu anēmija – inficēšanās ar Isavirus ģints vīrusu, kuram genomā nav izteikti polimorfisks reģions (infekciozā lašu anēmija bez izteikti polimorfiska reģiona jeb ILA (bez IPR)) Varavīksnes forele (Oncorhynchus mykiss),

Atlantijas lasis (Salmo salar),

taimiņš (Salmo trutta)

Divvāku molusku infekcijas slimības

11. Marteilioze Austrālijas dubļu austere (Ostrea angasi),

Čīles austere (Ostrea chilensis),

Eiropas plakanā jeb īstā (dabiskā) austere (Ostrea edulis),

Argentīnas austere (Ostrea puelchana),

mīdija (Mytilus edulis),

Vidusjūras mīdija (Mytilus galloprovencialis)

12. Bonamioze Austrālijas dubļu austere (Ostrea angasi),

Čīles austere (Ostrea chilensis),

Olimpijas plakanā austere (Ostrea conchphila),

Ostrea denselamellosa,

Eiropas plakanā jeb īstā (dabiskā) austere (Ostrea edulis),

Argentīnas austere (Ostrea puelchana)

Vēžveidīgo infekcijas slimība

13. Vēžu baltplankumu slimība Decapoda kārta

Iekšlietu ministrs Rihards Kozlovskis

 

2. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Uzraudzības un kontroles kārtība audzētavās un divvāku molusku audzēšanas zonās

Nr.
p.k.

Akvakultūras dzīvnieku suga

Veselības stāvoklis

Riska pakāpe

Uzraudzības veids

Dienesta amatpersonu inspekciju biežums

Veterinārārsta vizīšu biežums

Specifiski norādījumi inspekciju veikšanai, paraugu ņemšanai, kā arī uzraudzībai, kas nepieciešama, lai uzturētu atbilstošu veselības stāvokli

Komentāri

1. Audzētavā vai divvāku molusku audzēšanas zonā netiek turēti akvakultūras dzīvnieki, kas uzņēmīgi pret šo noteikumu 1. pielikumā minētajām infekcijas slimībām I kategorija (infekcijas slimības neskarta audzētava vai divvāku molusku audzēšanas zona saskaņā ar šo noteikumu 90.1., 90.2., 90.4., 93.1., 93.2. apakšpunktu)

Zema

Pasīva

Reizi četros gados

Reizi četros gados

Specifiskas prasības, lai saglabātu infekcijas slimības neskartas audzētavas vai divvāku molusku audzēšanas zonas statusu saskaņā ar šo noteikumu 98. punktu Ieteicamais pārbaužu biežums neattiecas uz īpašajām prasībām katram veselības stāvoklim. Minētās pārbaudes un paraugu ņemšanu apvieno ar dienesta inspekcijām un veterinārārsta vizītēm. Dienesta amatpersonas inspekciju mērķis ir veikt pārbaudes atbilstoši šo noteikumu 5. punktam.

Veterinārārsta vizīšu mērķis ir noskaidrot dzīvnieku veselības stāvokli, sniegt akvakultūras nozares uzņēmumu īpašniekiem padomus par akvakultūras dzīvnieku veselības jautājumiem

2. Akvakultūras dzīvnieku sugas, kas ir uzņēmīgas pret šo noteikumu 1. pielikumā minētajām infekcijas slimībām I kategorija (infekcijas slimības neskarta audzētava vai divvāku molusku audzēšanas zona saskaņā ar šo noteikumu 90.3. un 93.3. apakšpunktu)

Augsta

Aktīva, mērķtiecīga vai pasīva

Reizi gadā

Reizi gadā

   

Vidēja

 

Reizi divos gados

Reizi divos gados

Zema

 

Reizi divos gados

Reizi divos gados

II kategorija (infekcijas slimības skarta audzētava vai divvāku molusku audzēšanas zona, kas pakļauta uzraudzības programmai saskaņā ar šo noteikumu 74., 75. un 76. punktu)

Augsta

Mērķtiecīga

Reizi gadā

Reizi gadā

Specifiskas prasības saskaņā ar šo noteikumu 74., 75. un 76. punktu

Vidēja

 

Reizi divos gados

Reizi divos gados

Zema

 

Reizi divos gados

Reizi divos gados

III kategorija (nav zināms, vai audzētava vai divvāku molusku audzēšanas zona ir inficēta, un nav ieviesta uzraudzības programma, lai iegūtu infekcijas slimības neskartas audzētavas vai divvāku molusku audzēšanas zonas statusu)

Augsta

Aktīva

Reizi gadā

Trīs reizes gadā

 

Vidēja

 

Reizi gadā

Divas reizes gadā

Zema

 

Reizi divos gados

Reizi gadā

3.   IV kategorija (ir zināms, ka audzētava vai divvāku molusku audzēšanas zona ir inficēta, tā ir pakļauta apkarošanas programmai saskaņā ar šo noteikumu 77. punktu)

Augsta

Mērķtiecīga

Reizi gadā

Reizi gadā

Specifiskas prasības saskaņā ar šo noteikumu 77. punktu  

Vidēja

Reizi divos gados

Reizi divos gados

Zema

Reizi divos gados

Reizi divos gados

V kategorija (ir zināms, ka audzētava vai divvāku molusku audzēšanas zona ir inficēta, tā ir pakļauta minimālajiem kontroles pasākumiem saskaņā ar šo noteikumu V, VI, VII, VIII un IX nodaļu)

Augsta

Pasīva

Reizi četros gados (specifiskas prasības)

Reizi gadā

Specifiskas prasības saskaņā ar šo noteikumu V, VI, VII, VIII un IX nodaļu

Vidēja

Reizi divos gados

Reizi divos gados

Zema

Reizi četros gados

Reizi četros gados

Iekšlietu ministrs Rihards Kozlovskis

 

3. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Audzēšanai un krājumu atjaunošanai paredzētu akvakultūras dzīvnieku veselības stāvoklis un tā sertifikācija zonās un iecirkņos

Nr.
p.k.

Kategorija

Veselības stāvoklis

Atļauts ievest akvakultūras dzīvniekus

Veselības sertifikācija

Akvakultūras dzīvniekus atļauts nosūtīt

ievietot

izvest

1. I Infekcijas slimības neskarta zona vai iecirknis Tikai no I kategorijas zonas vai iecirkņa Nav atļauts, ja izved uz III vai V kategorijas zonu vai iecirkni.

Atļauts, ja izved uz I, II vai IV kategorijas zonu vai iecirkni

Uz jebkuras kategorijas zonu vai iecirkni
2. II Tiek īstenota uzraudzības un apkarošanas programma Tikai no I kategorijas zonas vai iecirkņa Uz III un V kategorijas zonu vai iecirkni
3. III Veselības stāvoklis nav noteikts (nav zināms, vai zona vai iecirknis ir inficēts, un netiek īstenota programma, lai iegūtu infekcijas slimības neskartas zonas vai iecirkņa statusu) No I, II un III kategorijas zonas vai iecirkņa Uz III un V kategorijas zonu vai iecirkni
4. IV Zonā vai iecirknī tiek īstenota apkarošanas programma Tikai no I kategorijas zonas vai iecirkņa Tikai uz V kategorijas zonu vai iecirkni
5. V Inficēta zona vai iecirknis No jebkuras kategorijas zonas un iecirkņa Tikai uz V kategorijas zonu vai iecirkni

Iekšlietu ministrs Rihards Kozlovskis

 

4. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes divu gadu uzraudzības programmas shēma

Nr.
p.k.

Audzētavas veids

Veselības pārbaužu skaits gadā (divos gados)

Paraugu ņemšanas skaits gadā (divos gados)

Zivju skaits paraugā1

augošo zivju skaits

zivju vaislinieku skaits2

1. Audzētavas ar vaisliniekiem

2

2

50
(pirmā pārbaude)

75
(otrā pārbaude)

30
(pirmā vai otrā pārbaude)

0
(pirmā vai otrā pārbaude)

2. Audzētavas, kurās ir tikai vaislinieki

2

1

0

75
(pirmā vai otrā pārbaude)

3. Audzētavas bez vaisliniekiem

2

2

753
(pirmā un otrā pārbaude)

0

Piezīmes.
1 Paraugus ņem ne agrāk kā trīs nedēļas pēc zivju pārcelšanas no saldūdens sālsūdenī.
2 Vaislinieku olšūnu vai pieņu šķidrumu iegūst brieduma fāzē ar noslaukšanas metodi.
3 Paraugus ņem no tāda zivju skaita, lai tad, ja slimības izplatība paredzēta 5 % gadījumu, virālā hemorāģiskā septicēmija un infekciozā hematopoētiskā nekroze tiktu noteikta ar 95 % ticamību.
4. Maksimālais zivju skaits kopparaugā – 10.

Iekšlietu ministrs Rihards Kozlovskis

 

5. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Laboratoriskā diagnostika un paraugu ņemšanas metodes infekciozās hematopoētiskās nekrozes vai virālās hemorāģiskās septicēmijas diagnostikai

1. Orgāni, no kuriem ņem paraugus (kopparaugā atļauts apvienot ne vairāk kā 10 zivju orgānu vai to daļu):

1.1. izmeklējamais audu materiāls ir liesa, nieru priekšdaļa un sirds vai galvas smadzenes. No vaisliniekiem ņemtajos paraugos var izmeklēt arī ikru vai pieņu šķidrumu;

1.2. par 4 cm īsākus zivju mazuļus pēc tam, kad atdalīta ķermeņa daļa aiz zarnu atveres, var sasmalcināt ar sterilām grieznēm vai skalpeli. No 4 līdz 6 cm garām zivīm ievāc iekšas un nieres.

2. Lai attiecībā uz virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts", laboratoriskai diagnostikai izvēlas vienu no šādām metodēm:

2.1. vīrusu izolēšanu šūnu kultūrās, pēc kuras veic identifikāciju, izmantojot imūnfermentatīvo analīzi (ELISA), netiešās imūnfluorescences antivielu testu (IFAT), vīrusneitralizācijas testu vai reāllaika apgrieztās transkriptāzes polimerāzes ķēdes reakcijas testu (RT-qPCR);

2.2. vīrusa noteikšanu ar RT-qPCR.

3. Ja nepieciešams apstiprināt vai izslēgt aizdomas par virālo hemorāģisko septicēmiju, infekciozo hematopoētisko nekrozi vai abām šīm infekcijas slimībām, ievēro šādu pārbaudes, paraugu ņemšanas un laboratoriskās izmeklēšanas kārtību:

3.1. audzētavā veic vismaz vienu veselības pārbaudi un, ja klīniski vai post mortem ir novērotas virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes infekcijai vai abām šīm infekcijas slimībām raksturīgās pazīmes, ņem paraugu ar 10 zivīm vai, ja klīniski vai post mortem šādas pazīmes nav novērotas, ņem paraugu ar vismaz 30 zivīm. Paraugus laboratoriski izmeklē, izmantojot šo noteikumu 13. pielikumā minētās laboratoriskās diagnostikas metodes, vai izmanto:

3.1.1. parasto vīrusa izolēšanu šūnu kultūrā, pēc tās veicot imūnķīmisku vai molekulāru vīrusa identificēšanu;

3.1.2. vīrusa noteikšanu ar RT-qPCR;

3.1.3. citus diagnostiskus paņēmienus ar pierādītu līdzvērtīgu rezultativitāti, piemēram, netiešās imūnfluorescences antivielu testu (IFAT), imūnfermentatīvo analīzi (ELISA), RT-qPCR un imūnhistoķīmisko analīzi (IHC);

3.2. virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes klātbūtni uzskata par apstiprinātu, ja, izmantojot vienu vai vairākas minētās diagnostikas metodes, ir iegūti pozitīvi rezultāti attiecībā uz virālās hemorāģiskās septicēmijas vīrusu vai infekciozās hematopoētiskās nekrozes vīrusu. Apstiprinot pirmo virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes gadījumu iepriekš neinficētā Latvijas valsts teritorijā, zonā vai iecirknī, pamatojas uz rezultātiem, kas iegūti parastā vīrusa izolēšanas testā šūnu kultūrā vai RT-qPCR;

3.3. ja šūnu kultivēšanas testi vai RT-qPCR testi neapliecina virālās hemorāģiskās septicēmijas vīrusa vai infekciozās hematopoētiskās nekrozes vīrusa klātbūtni, aizdomas par virālās hemorāģiskās septicēmijas vīrusu vai infekciozās hematopoētiskās nekrozes vīrusu var izslēgt.

Iekšlietu ministrs Rihards Kozlovskis

 

6. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes četru gadu uzraudzības programmas shēma

Nr.
p.k.

Audzētavas veids

Veselības pārbaužu skaits gadā

Paraugu ņemšanas skaits gadā

Zivju skaits paraugā1

augošo zivju skaits

zivju vaislinieku skaits2

Pirmie divi uzraudzības perioda gadi

1. Audzētavas ar vaisliniekiem

2

1

0
(pirmā pārbaude)

30
(otrā pārbaude)

0
(pirmā pārbaude)

0
(otrā pārbaude)

2. Audzētavas, kurās ir tikai vaislinieki

2

1

0

30
(pirmā vai otrā pārbaude)

3. Audzētavas bez vaisliniekiem

2

1

303
(pirmā vai otrā pārbaude)

0

Pēdējie divi uzraudzības perioda gadi

4. Audzētavas ar vaisliniekiem

2

2

30
(pirmā pārbaude)

0
(otrā pārbaude)

0
(pirmā pārbaude)

30
(otrā pārbaude)

5. Audzētavas, kurās ir tikai vaislinieki

2

2

 

30
(pirmā un otrā pārbaude)

6. Audzētavas bez vaisliniekiem

2

2

303
(pirmā un otrā pārbaude)

 
Piezīmes.
1 Paraugus ņem ne agrāk kā trīs nedēļas pēc zivju pārcelšanas no saldūdens sālsūdenī.
2 Vaislinieku olšūnu vai pieņu šķidrumu iegūst brieduma fāzē ar noslaukšanas metodi.
3 Paraugus ņem no tāda zivju skaita, lai tad, ja slimības izplatība paredzēta 10 % gadījumu, virālā hemorāģiskā septicēmija un infekciozā hematopoētiskā nekroze tiktu noteikta ar 95 % ticamību.
4. Maksimālais zivju skaits kopparaugā – 10.

Iekšlietu ministrs Rihards Kozlovskis

 

7. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Uzraudzības shēma veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai attiecībā uz virālo hemorāģisko septicēmiju vai infekciozo hematopoētisko nekrozi

Nr.
p.k.

Riska pakāpe

Veselības pārbaužu skaits

Zivju skaits paraugā

1. Augsta Divas reizes gadā 301, 2
2. Vidēja Reizi gadā 301
3. Zema Reizi divos gados 301
Piezīmes.
1 Paraugus ņem ne agrāk kā trīs nedēļas pēc zivju pārcelšanas no saldūdens sālsūdenī.
2 Paraugus ņem no tāda zivju skaita, lai tad, ja slimības izplatība paredzēta 10 % gadījumu, virālā hemorāģiskā septicēmija un infekciozā hematopoētiskā nekroze tiktu noteikta ar 95 % ticamību.
3 Katras veselības pārbaudes laikā paņem vismaz vienu paraugu.
4. Maksimālais zivju skaits kopparaugā – 10.

Iekšlietu ministrs Rihards Kozlovskis

 

8. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Diagnostikas un paraugu ņemšanas metodes, lai iegūtu un saglabātu veselības stāvokli "infekcijas slimības neskarts" attiecībā uz koiju herpesvīrusa slimību

1. Koiju herpesvīrusa slimības diagnostikas paraugam iesūta audu materiālu, kurā ir žaunu un nieru daļas. Kopparaugā atļauts apvienot divu zivju orgānu daļas.

2. Lai attiecībā uz koiju herpesvīrusa slimību iegūtu un saglabātu veselības stāvokli "infekcijas slimības neskarts", uzraudzībai paredzētā diagnostikas metode ir reāllaika PCR (qPCR).

3. Lai apstiprinātu vai izslēgtu aizdomas par inficēšanos ar koiju herpesvīrusu, ievēro šādu paraugu ņemšanas un laboratoriskās izmeklēšanas kārtību:

3.1. laboratoriskai izmeklēšanai uz koiju herpesvīrusu iesūta šā pielikuma 1. punktā minētajai prasībai atbilstošus paraugus;

3.2. ja klīniski vai pēc nāves (post mortem) ir novērotas koiju herpesvīrusa slimībai raksturīgas pazīmes, oficiālajā izmeklēšanā veic vismaz vienu veselības pārbaudi un ņem vienu paraugu ar 10 zivīm vai, ja šādas pazīmes klīniski vai post mortem nav novērotas, ņem paraugu ar 30 zivīm;

3.3. paraugus laboratoriski izmeklē, ievērojot šo noteikumu 13. pielikumā norādītās diagnostikas metodes un procedūras, lai izslēgtu vai apstiprinātu koiju herpesvīrusu;

3.4. koiju herpesvīrusa slimību uzskata par apstiprinātu, ja, izmantojot PCR, konstatē koiju herpesvīrusu;

3.5. ja izmantotais laboratoriskais tests koiju herpesvīrusa klātbūtni neapliecina, aizdomas par koiju herpesvīrusa slimību var izslēgt.

Koiju herpesvīrusa slimības divu gadu uzraudzības programmas shēma

2.A tabula

   

Klīnisko pārbaužu skaits gadā (divos gados)

Laboratorisko izmeklējumu skaits gadā (divos gados)

Zivju skaits paraugā

Audzētavas/paraugu ņemšanas vietas Pirmie divi uzraudzības perioda gadi

2

2

751

Maksimālais zivju skaits kopparaugā – 2
Piezīme. 1 Paraugus ņem no tāda zivju skaita, lai tad, ja slimības izplatība paredzēta 5 % gadījumu, koiju herpesvīruss tiktu noteikts ar 95 % ticamību

Koiju herpesvīrusa slimības četru gadu uzraudzības programmas shēma

2.B tabula

   

Klīnisko pārbaužu skaits gadā

Laboratorisko izmeklējumu skaits gadā

Zivju skaits paraugā

Audzētavas/paraugu ņemšanas vietas Pirmie divi uzraudzības perioda gadi

1

1

30

Audzētavas/paraugu ņemšanas vietas Pēdējie divi uzraudzības perioda gadi

2

2

30

Piezīme. Maksimālais zivju skaits kopparaugā – 2

Uzraudzības shēma veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai attiecībā uz koiju herpesvīrusa slimību

2.C tabula

Riska pakāpe

Veselības pārbaužu skaits

Zivju skaits paraugā

Augsta Divas reizes gadā 30
Vidēja Reizi gadā 30
Zema Reizi divos gados 30
Maksimālais zivju skaits kopparaugā – 2

Uzraudzības shēma veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai attiecībā uz koiju herpesvīrusa slimību Latvijas valsts teritorijā, zonā vai iecirknī, kurā audzētavu skaits ir ierobežots un to mērķtiecīga uzraudzība nesniedz pietiekami daudz epizootoloģisko datu

2.D tabula

 

Klīnisko pārbaužu skaits gadā

Laboratorisko izmeklējumu skaits gadā

Zivju skaits paraugā

Paraugu ņemšanas punkti

Reizi divos gados

Reizi divos gados

30

Piezīme. Maksimālais zivju skaits kopparaugā – 2

Iekšlietu ministrs Rihards Kozlovskis

 

9. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Infekciozās lašu anēmijas diagnostikas metodes un oficiālie izmeklējumi

1. Lai noteiktu infekciozo lašu anēmiju, laboratoriskai izmeklēšanai iesūta šādus paraugus:

1.1. galvasnieri, aknas, sirdi, aizkuņģa dziedzeri, zarnas, liesu un žaunas – histoloģiskai analīzei;

1.2. vidusnieri, sirdi ar vārstuļiem un bulbus arteriosus – imūnhistoķīmiskai analīzei;

1.3. vidusnieri un sirdi – RT-qPCR analīzei;

1.4. vidusnieri, sirdi, aknas un liesu – vīrusu kultūrai.

2. Kopparaugā atļauts apvienot ne vairāk kā piecu zivju orgānu daļas.

3. Lai iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts", laboratoriskajā diagnostikā izmanto RT-qPCR metodi. Pozitīvos paraugus pēc tam sekvenē, izmantojot šo noteikumu 13. pielikumā minētās laboratoriskās diagnostikas metodes un ievērojot noteikto kārtību.

4. Ja RT-qPCR rezultāts ir pozitīvs, pirms šo noteikumu 48. punktā paredzēto sākotnējo kontroles pasākumu īstenošanas papildus laboratoriski izmeklē vēl citus paraugus.

5. Izmantojot šo noteikumu 13. pielikumā minētās laboratoriskās diagnostikas metodes un ievērojot noteikto kārtību, paraugiem veic skrīningu ar RT-qPCR, arī sekvenē HE gēnu, lai pārliecinātos par tāda vīrusa esību vai neesību, kura genomā nav izteikti polimorfiska reģiona, un izmanto vienu no šādiem paņēmieniem:

5.1. audu preparātus izmeklē ar specifiskām infekciozās lašu anēmijas vīrusa antivielām (fiksētiem griezumiem ar IHC, audu nospiedumiem – ar IFAT);

5.2. vismaz no viena parauga jebkuras audzētavā paraugam paņemtas zivs izolē un identificē infekciozās lašu anēmijas vīrusu šūnu kultūrā.

6. Lai saskaņā ar šo noteikumu 48. punktu apstiprinātu vai izslēgtu aizdomas par infekciozo lašu anēmiju, ievēro šādu oficiālās izmeklēšanas kārtību un diagnostikas procedūras:

6.1. ja oficiālās izmeklēšanas laikā klīniski vai post mortem novēro infekciozai lašu anēmijas infekcijai raksturīgas pazīmes, veic vismaz vienu veselības pārbaudi un ņem vienu paraugu ar 10 mirstošām zivīm. Ja klīniski vai post mortem infekciozai lašu anēmijai raksturīgas pazīmes nav novērotas, pēc veselības pārbaudes saskaņā ar šo noteikumu 216. un 217. punktu selektīvi ņem paraugus no vismaz 30 mirstošām zivīm vai nesen mirušām zivīm (ar normālu ķermeņa uzbūvi). Paraugus laboratoriski izmeklē, izmantojot šā pielikuma 6.2. apakšpunktā noteiktās diagnostikas metodes;

6.2. ja ar RT-qPCR metodi attiecībā uz infekciozās lašu anēmijas vīrusu ar genotipu ILA (bez IPR) ir iegūts pozitīvs rezultāts, pirms šo noteikumu 48. punktā minēto sākotnējo kontroles pasākumu īstenošanas laboratoriski izmeklē vēl citus paraugus. Izmantojot šo noteikumu 11. pielikumā noteiktās laboratoriskās diagnostikas metodes, aizdomas par inficēšanos ar infekciozo lašu anēmiju apstiprina, ja ir spēkā viens no šādiem variantiem:

6.2.1. konstatē infekciozās lašu anēmijas vīrusu ar RT-qPCR, arī sekvenējot HE gēnu, lai pārliecinātos par tāda vīrusa klātbūtni, kura genomā nav izteikti polimorfiska reģiona, un ar specifisku infekciozās lašu anēmijas vīrusa antivielu starpniecību (fiksētiem griezumiem ar IHC, bet audu nospiedumiem – ar IFAT) infekciozās lašu anēmijas vīrusu konstatē audu preparātos;

6.2.2. infekciozās lašu anēmijas vīrusu konstatē ar RT-qPCD metodi, arī sekvenējot HE gēnu, lai pārliecinātos par tāda vīrusa klātbūtni, kura genomā nav izteikti polimorfiska reģiona, kā arī, izmantojot vismaz vienu paraugu no jebkuras zivs audzētavā, infekciozās lašu anēmijas vīrusu izolē un identificē šūnu kultūrā;

6.3. atradnēs, kurās klīniski novērojamas smagas patoloģiskas pārmaiņas vai kuras histopatoloģiski liecina par infekciozo lašu anēmiju, vīrusu apstiprināšanai izmeklējumus veic ar divām diagnostikas metodēm, kuru pamatā ir neatkarīgi konstatēšanas principi (piemēram, ar RT-qPCR un IHC).

7. Aizdomas par infekciozo lašu anēmiju var izslēgt, ja tiek konstatēts, ka 12 mēnešu laikā kopš aizdomu rašanās laboratoriskajos izmeklējumos un pārbaudēs nav iegūti nekādi pierādījumi par infekciozās lašu anēmijas klātbūtni.

Divu gadu kontroles perioda uzraudzības shēma, ko īsteno pirms veselības stāvokļa "infekcijas slimības neskarts" iegūšanas attiecībā uz infekciozo lašu anēmiju

3.A tabula

Uzraudzības gads

Veselības pārbaužu skaits gadā (divos gados)

Laboratorisko izmeklējumu skaits gadā (divos gados)

Gadā ņemamo zivju paraugu skaits

1. gads

6

21

2 x 752

2. gads

6

21

2 x 752

Piezīmes.
1 Gada laikā paraugi jāņem, jāglabā un jāizmeklē divos mēnesi ilgos testēšanas periodos (pavasarī un rudenī) vai tad, kad tas praktisku apsvērumu dēļ ir lietderīgi.
2 Maksimālais zivju skaits kopparaugā – 5.

Uzraudzības shēma veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai2 attiecībā uz infekciozo lašu anēmiju

3.B tabula

Nr.
p.k.

Riska pakāpe

Veselības pārbaužu skaits gadā

Laboratorisko izmeklējumu skaits gadā

Gadā ņemamo zivju paraugu skaits

1. Augsta

2

21

2 x 30

2. Vidēja

1

11

30

3. Zema

Reizi divos gados

Reizi divos gados

30 reizes divos gados

Piezīmes.
1 Paraugi gada laikā jāņem un jāizmeklē divos mēnesi ilgos testēšanas periodos (pavasarī un rudenī) vai tad, kad tas praktisku apsvērumu dēļ ir lietderīgi.
2 Neattiecas uz audzētavām, kurās audzē tikai varavīksnes foreli (Onchorhynchus mykiss), strauta foreli (Salmo trutta) vai tās abas un kurās ūdeni piegādā tikai no saldūdens apgādes avotiem, kur nedzīvo Atlantijas lasis (Salmo salar).

Iekšlietu ministrs Rihards Kozlovskis

 

10. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Marteiliozes diagnostikas metodes un oficiālie izmeklējumi

1. Paraugs laboratoriskiem izmeklējumiem ir viss gliemenes ķermenis.

2. Lai attiecībā uz inficēšanos ar Marteilia refringens iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts", izmanto šo noteikumu 13. pielikumā norādītās laboratoriskās diagnostikas metodes – histopatoloģiju, audu nospiedumus vai PCR.

3. Lai oficiāli apstiprinātu inficēšanos ar Marteilia refringens vai izslēgtu aizdomas par inficēšanos ar to, ievēro šādu pārbaudes, paraugu ņemšanas un laboratoriskās izmeklēšanas kārtību:

3.1. pēc Marteilia refringens izplatības perioda sākšanās organizē veselības pārbaudi un paņem vienu oficiālo paraugu ar 30 uzņēmīgo sugu gliemenēm, ja aizdomu pamatā ir ziņas par mirstību, vai ar 150 uzņēmīgo sugu gliemenēm, ja ziņu par mirstību nav bijis. Ja Marteilia refringens izplatības periods nav zināms, paraugus sāk ņemt sezonā, kad ūdens temperatūra ir pārsniegusi 17 °C;

3.2. paraugu laboratoriskajā izmeklēšanā:

3.2.1. Marteilia refringens klātbūtni uzskata par apstiprinātu tad, ja pozitīvs rezultāts iegūts ne tikai histopatoloģijā, ar audu nospiedumiem vai in situ hibridizācijā, bet arī ar PCR, pēc kuras izdarīta sekvenēšana;

3.2.2. aizdomas par inficēšanos ar Marteilia refringens var izslēgt, ja šā pielikuma 3.2.1. apakšpunktā minētie testi par Marteilia refringens klātbūtni neliecina.

Uzraudzības shēma kontroles periodā pirms veselības stāvokļa "infekcijas slimības neskarts" iegūšanas attiecībā uz marteiliozi

4.A tabula

 

Veselības pārbaužu skaits gadā

Laboratorisko izmeklējumu skaits gadā

Gliemeņu skaits paraugā

Gliemeņu audzēšanas zona

1

1

150

Uzraudzības shēma veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai attiecībā uz marteiliozi

4.B tabula

Nr.
p.k.

Riska pakāpe

Veselības pārbaužu skaits

Laboratorisko izmeklējumu skaits

Gliemeņu skaits paraugā

1. Augsta Reizi gadā Reizi divos gados

150

2. Vidēja Reizi divos gados Reizi divos gados

150

3. Zema Reizi divos gados Reizi četros gados

150

Iekšlietu ministrs Rihards Kozlovskis

 

11. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Bonamiozes diagnostikas metodes un kritēriji

1. Paraugs laboratoriskajiem izmeklējumiem ir viss gliemenes ķermenis.

2. Lai attiecībā uz inficēšanos ar Bonamia ostrea iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts" (I kategorija), ir izmantojamas šo noteikumu 13. pielikumā noteiktās diagnostikas metodes – histopatoloģija, audu nospiedumi vai PCR.

3. Lai oficiāli apstiprinātu inficēšanos ar Bonamia ostrea vai izslēgtu aizdomas par inficēšanos ar to, ievēro šādu pārbaudes, paraugu ņemšanas un laboratoriskās izmeklēšanas kārtību:

3.1. organizē veselības pārbaudi un paņem vienu oficiālo paraugu ar 30 uzņēmīgo sugu gliemenēm pēc Bonamia ostrea izplatības perioda sākšanās, ja aizdomu pamatā ir ziņas par mirstību, vai ar 150 uzņēmīgo sugu gliemenēm, ja ziņu par mirstību nav bijis. Ja transmisijas periods nav zināms, paraugus sāk ņemt ziemā vai pavasara sākumā;

3.2. paraugu laboratoriskajā izmeklēšanā:

3.1.1. Bonamia ostreae klātbūtni uzskata par apstiprinātu tad, ja papildus pozitīvam rezultātam, kas iegūts histopatoloģijā, ar audu nospiedumiem vai in situ hibridizācijā, šāds rezultāts ir iegūts arī PCR, pēc kuras izdarīta sekvenēšana;

3.1.2. aizdomas par Bonamia ostreae infekcijas klātbūtni var izslēgt, ja šā pielikuma 3.1.1. apakšpunktā minētie testi Bonamia ostreae klātbūtni neapliecina.

Uzraudzības shēma kontroles periodā pirms veselības stāvokļa "infekcijas slimības neskarts" iegūšanas attiecībā uz Bonamia ostreae

5.A tabula

 

Veselības pārbaužu skaits gadā

Laboratorisko izmeklējumu skaits gadā

Gliemeņu skaits paraugā

Gliemeņu audzēšanas zonas

1

1

150

Uzraudzības shēmas veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai attiecībā uz Bonamia ostreae

5.B tabula

Nr.
p.k.

Riska pakāpe

Veselības pārbaužu skaits

Laboratorisko izmeklējumu skaits

Gliemeņu skaits paraugā

1. Augsta Reizi gadā Reizi divos gados

150

2. Vidēja Reizi divos gados Reizi divos gados

150

3. Zema Reizi divos gados Reizi četros gados

150

Iekšlietu ministrs Rihards Kozlovskis

 

12. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Vēžu baltplankumu slimības diagnostikas metodes un paraugu ņemšanas kārtība

1. Paraugi vēžu baltplankumu slimības diagnostikai ir:

1.1. 95 % etilspirtā fiksēts epidermas (kājas, vēderkājas, mutes daļas vai žaunu) paraugs;

1.2. citi paraugi, kas ar fiksēšanu sagatavoti histoloģiskai pārbaudei un mikroskopēšanai ar transmisijas elektronu mikroskopu, lai veiktu PCR.

2. Lai attiecībā uz vēžu baltplankumu slimību iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts", izmanto šo noteikumu 13. pielikumā norādīto diagnostikas metodi – divsoļu PCR.

3. Ja divsoļu PCR testa laikā ir iegūts pozitīvs rezultāts, pirms šo noteikumu 48. punktā minēto kontroles un apkarošanas pasākumu īstenošanas rezultātu apstiprina, sekvenējot amplikonu, – ja iespējams, paraugam ņemtajos uzņēmīgajos saimniekorganismos ar histoloģiskas pārbaudes un transmisijas elektronu mikroskopa starpniecību praktiski pierādot patognomiskas vēžu baltplankumu slimības pazīmes.

4. Ja saskaņā ar šo noteikumu 48. punktā minētajām prasībām nepieciešams apstiprināt vēžu baltplankumu slimības infekcijas klātbūtni vai izslēgt aizdomas par to, ievēro šādu oficiālo izmeklēšanas, paraugu ņemšanas un laboratoriskās izmeklēšanas kārtību:

4.1. ja klīniski vai post mortem novēro vēžu baltplankumu slimībai raksturīgas pazīmes, oficiālajā izmeklēšanā veic vismaz vienu veselības pārbaudi un ņem vienu paraugu ar 10 vēžveidīgajiem vai, ja šādas pazīmes klīniski vai post mortem nenovēro, ņem paraugu ar 150 vēžveidīgajiem. Paraugus laboratoriski izmeklē, izmantojot šā pielikuma 2. un 3. punktā aprakstīto divsoļu PCR;

4.2. vēžu baltplankumu slimības klātbūtni uzskata par apstiprinātu, ja divsoļu PCR, pēc kuras izdarīta sekvenēšana attiecībā uz baltplankumu sindroma vīrusa 1. tipu, ir pozitīva un ja paraugam ņemtajos saimniekorganismos ir vērojamas patognomiskas vēžu baltplankumu slimības pazīmes.

5. Ja šā pielikuma 4. punktā minēto laboratorisko izmeklējumu laikā vēžu baltplankumu slimības klātbūtni neapliecina, aizdomas par vēžu baltplankumu slimību izslēdz.

Uzraudzības shēma divu gadu kontroles periodam pirms veselības stāvokļa "infekcijas slimības neskarts" iegūšanas attiecībā uz vēžu baltplankumu slimību

6.A tabula

 

Klīnisko pārbaužu skaits gadā

Laboratorisko izmeklējumu skaits gadā

Vēžveidīgo skaits paraugā

Audzētavas/
paraugu ņemšanas vietas

1

1

150

Uzraudzības shēma veselības stāvokļa "infekcijas slimības neskarts" saglabāšanai attiecībā uz vēžu baltplankumu slimību

6.B tabula

Nr.
p.k.

Riska pakāpe

Veselības pārbaužu skaits

Laboratorisko izmeklējumu skaits

Vēžveidīgo skaits paraugā

1. Augsta Reizi gadā Reizi divos gados

150

2. Vidēja Reizi divos gados Reizi divos gados

150

3. Zema Reizi divos gados Reizi četros gados

150

Iekšlietu ministrs Rihards Kozlovskis

 

Zemkopības ministrijas iesniegtajā redakcijā

13. pielikums
Ministru kabineta
2017. gada 14. marta
noteikumiem Nr. 146

Laboratoriskās diagnostikas metodes

I. Laboratoriskās diagnostikas metodes virālās hemorāģiskās septicēmijas un infekciozās hematopoētiskās nekrozes uzraudzībai

Šajā nodaļā noteiktās laboratoriskās diagnostikas metodes izmanto, lai iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts" no virālās hemorāģiskās septicēmijas un infekciozās hematopoētiskās nekrozes.

1. Zivju paraugu sagatavošanas un nosūtīšanas kārtība.

1.1. Paraugus, paredzētus šūnu kultūru virusoloģiskai izmeklēšanai sagatavo šādā kārtībā:

Pirms nosūtīšanas vai pārvešanas uz laboratoriju izmeklējamās orgānu daļas no zivs ķermeņa izņem ar steriliem secēšanas instrumentiem un ievieto sterilās plastmasas mēģenēs ar transporta barotni.

Šūnu kultūru virusoloģiskai izmeklēšanai un RT-qPCR nepieciešamais zivju materiāla daudzums ir atkarīgs no zivju lieluma. Piemēram, zivju kāpuriem, kuru garums ir mazāks par 4 cm, paraugam ņem visu zivs kāpura ķermeni, 4 līdz 6 cm garām zivīm - ņem iekšas kopā ar nierēm, par 6 cm lielākām zivīm – ņem nieres, liesu, sirdi un/vai galvas smadzenes, bet vaislas zivīm nārsta laikā – ņem olšūnu šķidrumu.

Sterilā mēģenē, kurā ir ne mazāk kā 4 ml transporta barotnes, ievieto olšūnu vai spermas šķidrumu, zivs kāpuru vai zivs orgānu daļas, iegūtas ne vairāk kā no desmit zivīm, kas veido vienu kopotu paraugu. Katra individuālā parauga audu svars ir ne mazāk kā 0,5 grami.

Šūnu kultūras virusoloģisko izmeklēšanu sāk iespējami drīz pēc parauga nogādāšanas laboratorijā, bet ne vēlāk kā 48 stundas pēc paraugu noņemšanas. Izņēmuma gadījumos, ja pārbaudāmo materiālu aizsargā transporta barotne un ja pārvadāšanas laikā ievēro prasības attiecībā uz parauga transportēšanas temperatūru, kā tas noteikts šīs nodaļas 2. punktā, virusoloģisko izmeklēšanu var sākt vēlākais 72 stundas pēc parauga materiāla ievākšanas.

1.2. Paraugus, paredzētus apgrieztās transkriptāzes polimerāzes ķēdes reakcijas analīzei (RT-PCR vai RT-qPCR) sagatavo šādā kārtībā:

Paraugus no zivīm ar sterilu instrumentu ņem saskaņā ar šīs nodaļas 1.1. apakšpunktā aprakstīto procedūru un ievieto sterilā plastmasas mēģenē ar transporta barotni. Vienā mēģenē var ievietot paraugus no 10 zivīm, un tie veido vienu kopotu paraugu. Ja inokulāta apjoms ir neliels, var izmantot audus ne vairāk kā no piecām zivīm. Paraugus, ievērojot ražotāja ieteikumus, atļauts kopot ribonukleīnskābi (turpmāk – RNS) stabilizējošos reaģentos (piemēram: uz 1 ml reaģenta izmanto 0,2 g audu). Ja ekstrahēšanai lietojamā materiāla ir maz, katru zivi apstrādā atsevišķi un neliek kopotos paraugos.

Uz laboratoriju atļauts sūtīt veselas zivis.

2. Zivju paraugus nosūta uz laboratoriju šādā kārtībā:

Paraugu transportēšanas laikā uz laboratoriju nodrošina paraugu atdzesēšanu. Mēģenes ar šūnu kultivēšanai vai RT-PCR / RT-qPCR analīzei paredzētiem zivju audiem transporta barotnē nosūta kopā ar pietiekamu daudzumu ledus vai alternatīvu dzesēšanas vidi un ievietotas izotermiskos konteineros (piemēram, polistirola kastēs ar biezām sienām). Transportēšanas laikā nav nepieļaujama paraugu sasalšana. Parauga temperatūra pārvadāšanas laikā nedrīkst pārsniegt 10 °C, un transportēšanas kastē, to saņemot laboratorijā, ir jābūt ledum vai arī vienam vai vairākiem daļēji vai pilnīgi sasalušiem aukstuma elementu saturošiem blokiem.

Ja pārvadāšanas laikā iespējams nodrošināt vidi, kas atbilst iepriekšējā rindkopā minētajām prasībām attiecībā uz temperatūru, uz laboratoriju var nosūtīt veselas zivis. Veselas zivis ietin absorbējošā papīrā, kuru ievieto plastikāta maisā. Sūtīt var arī dzīvas zivis.

3. Papildu diagnostisko materiālu ievāc šādā kārtībā: ja diagnostikas laboratorija atļauj, ievākt un papildu izmeklējumiem sagatavot var arī citus zivs audus.

4. Paraugu sagatavošana šūnu kultūras izmeklēšanai un RT-qPCR.

4.1. Atļauts veikt paraugu sasaldēšanu izņēmuma gadījumos. Ja paraugu apstrāde 48 stundu laikā pēc zivju audu ievākšanas nav iespējama, ir pieļaujams audu paraugus sasaldēt transporta barotnē – 20 °C vai zemākā temperatūrā un virusoloģisko izmeklēšanu veikt 14 dienu laikā. Pirms paraugu izmeklēšanas zivju audus atļauts sasaldēt un atkausēt tikai vienu reizi. Sasaldējot paraugus, norāda detalizētu informāciju par katru zivju audu paraugu sasaldēšanas iemeslu.

4.2. Orgānu homogenizēšana

Laboratorijā iesūtītos audus mēģenēs pilnīgi homogenizē (vai nu ar homogenizatoru Stomacher, blenderi, vai miezeri un piestu ar sterilām smiltīm) un pēc tam suspendē sākotnējā transporta barotnē.

Ja paraugu veido vesela zivs, kas īsāka par 4 cm, tai nodala ķermeņa daļu aiz zarnu atveres un pēc tam šādu zivs daļu sasmalcina ar sterilām grieznēm vai skalpeli. Ja paraugu veido vesela zivs, kuras garums ir no 4 līdz 6 cm, ievāc zivs iekšas, ieskaitot nieres. Ja paraugu veido vesela zivs, kas garāka par 6 cm, audu paraugus ņem, kā aprakstīts šīs nodaļas 1. punktā. Audu paraugus sasmalcina ar sterilām grieznēm vai skalpeli, homogenizē (vai nu ar homogenizatoru Stomacher, blenderi, vai miezeri un piestu ar sterilām smiltīm) un pēc tam suspendē sākotnējā transporta barotnē.

Galīgo attiecību starp audu materiālu un transporta barotni laboratorijā koriģē, panākot 1:10.

4.3. Homogenizētā materiāla centrifugēšana

Homogenizēto materiālu 15 minūtes centrifugē atdzesētā centrifūgā 2 °C līdz 5 °C temperatūrā ar 2000 līdz 4000 apgriezieniem/minūtē, un ievāc centrifugātu. Pēc centrifugāta iegūšanas, to četras stundas 15 °C temperatūrā, vai visu nakti 4 līdz 8 °C temperatūrā apstrādā ar antibiotikām. Transporta barotnē nosūtītu paraugu centrifugātu ar antibiotikām var neapstrādāt.

Ja šūnas nevar inokulēt 48 stundu laikā pēc zivju audu paraugu paņemšanas, centrifugātu atļauts sasaldēt – 80 °C temperatūrā un virusoloģisko izmeklēšanu veikt 14 dienu laikā.

Ja ievākto centrifugātu 48 stundas pēc parauga ņemšanas uzglabā – 80 °C temperatūrā, to var atkārtoti izmantot tikai vienu reizi virusoloģiskajai izmeklēšanai.

Pirms šūnu inokulēšanas centrifugātu vienādās daļās samaisa ar atbilstoši atšķaidītiem kopotiem antiserumiem pret infekciozās pankreātiskās nekrozes vīrusa vietējiem serotipiem un kopā ar šo maisījumu ne mazāk kā vienu stundu inkubē 15 °C temperatūrā vai ne vairāk kā 18 stundas 4 °C temperatūrā. Antiseruma titrs 50 % plaku samazināšanās testā ir vismaz 1:2000.

Visus inokulātus apstrādā ar infekciozās pankreātiskās nekrozes vīrusa antiserumu. Procedūra nepieciešama tāpēc, lai novērstu citopātisko efektu (turpmāk – CPE), ko inokulētās šūnu kultūrās rada infekciozās pankreātiskās nekrozes vīrusa attīstīšanās. Līdz ar to tas samazina virusoloģisko pārbaužu ilgumu, kā arī to gadījumu skaitu, kur būtu jāuzskata, ka radies CPE liecina par virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes vīrusu.

Ja paraugi ir no ražošanas vienībām, kuras ir brīvas no infekciozās pankreātiskās nekrozes, inokulātus ar infekciozās pankreātiskās nekrozes vīrusa antiserumu var neapstrādāt.

4.4. Paraugu gatavošana uzraudzības programmām, kuru pamatā ir RT-PCR un RT-pPCR

Ja paraugi ievietoti transporta barotnē, veic šīs nodaļas 4.2. un 4.3. apakšpunktā aprakstītās procedūras. Pēc centrifugēšanas ievāc centrifugātu un ekstrahē RNS. Ja tieši pēc centrifugēšanas nav jāveic tālāka izmeklēšana, paraugus tūlīt sasaldē −20 °C vai zemākā temperatūrā.

Ribonukleīnskābes stabilizējošā reaģentā konservētu zivju audu analizēšanas vajadzībām tālāku darbu ar atšķirīgā temperatūrā glabātiem paraugiem veic saskaņā ar šādu grafiku:

37 °C glabāti paraugi: viena diena,

25 °C glabāti paraugi: viena nedēļa,

4 °C glabāti paraugi: viens mēnesis,

- 20 °C glabāti paraugi: beztermiņa.

Ar kopotiem paraugiem RNS stabilizējošā reaģentā rīkojas tāpat, kā ar atsevišķiem paraugiem RNS stabilizējošā reaģentā. RNS stabilizējošā reaģentā ievietoto kopotu paraugu apjoms nedrīkst pārsniegt apjomu, ko ekstrahēšanai ar RNS komplektiem (tādiem kā RNeasy Mini kits (Qiagen) vai līdzīgiem) ieteicis ražotājs. Ja kopotie paraugi ir lielāki, ekstrahēšanas komplektiem vai metodēm jābūt tādiem, kas atbilst šādi veidotiem kopotiem paraugiem.

RNS stabilizējošos reaģentos ievāktus paraugus neizmanto šūnu kultivēšanai.

4.5. Rīcība ar kopotiem paraugiem, kuri paredzēti izmeklēšanai ar RT-qPCR metodi

Šajā nodaļā sniegto RT-qPCR protokolu jutība ir līdzvērtīga šūnu kultivēšanas metožu jutībai vai ir par to augstāka. PCR vajadzībām var izmantot centrifugātu, kas iegūts no barotnē ar šūnu kultūru homogenizēta zivju audu materiāla, kurš ņemts ne vairāk kā no 10 zivju kopotiem orgāniem. Salīdzinājumā ar šūnu kultivēšanu PCR testā izmanto daudz mazāk inokulāta, tāpēc, pirms likt kopā materiālu ekstrahēšanai, visi zivju audi rūpīgi jāhomogenizē.

Tas pats princips jāievēro arī tad, ja paraugus ievāc RNS stabilizējošos reaģentos. Ja reprezentatīvu materiālu no 10 zivīm vienā mēģenē ievākt ir grūti, zivju skaitu kopotā paraugā samazina līdz 2-5 zivīm.

5. Šūnu kultūru virusoloģiskā izmeklēšana

5.1. Šūnu kultūras un barotnes

20 līdz 30 °C temperatūrā piemērotā barotnē, proti, Īgla barotnē MEM vai tās modificētā variantā, pievienojot 10 % liellopu embrionālā seruma un antibiotikas standartkoncentrācijās, audzē zilžaunu sauleszivs šūnu līnijas-2 (BF-2), varavīksnes foreles gonādu šūnu līnijas-2 (RTG-2) un vai nu Epithelioma papulosum cyprini (EPC), vai melngalvas mailītes (FHM) šūnas.

Ja šūnas kultivē slēgtos stobriņos, barotni buferē ar bikarbonātu. Barotni, ko izmanto šūnu kultivēšanai vaļējos traukos, var buferēt ar tris-(hidroksimetil)aminometāna-HCl (Tris-HCl) (23 mM) un nātrija bikarbonātu (6 mM). pH jābūt 7,6 ± 0,2.

Šūnu kultūrām, ko paredzēts inokulēt ar zivju audu materiālu, jābūt jaunām (parasti, ja vien iespējams, tās ir vienu dienu vecu šūnu kultūru monoslāņi). Izņēmuma gadījumā ir pieņemams vecuma diapazons 4 līdz 48 stundas. Šūnām inokulātā aktīvi jāaug.

5.2. Šūnu kultūru inokulēšana

Lai novērstu homoloģisku interferenci, ar antibiotikām apstrādāto orgānu suspensiju šūnu kultūrās inokulē divos atšķaidījumos: primārajā atšķaidījumā un turklāt tā atšķaidījumā 1:10. Līdz ar to audu materiāla galīgie atšķaidījumi barotnē ar šūnu kultūru būs attiecīgi 1:100 un 1:1000. Atbilstoši šīs nodaļas 5.1. apakšpunktā aprakstītajai procedūrai inokulē vismaz divas no tajā minētajām šūnu līnijām. Attiecībai starp inokulāta apjomu un šūnu kultūru saturošās barotnes tilpumu jābūt apmēram 1:10.

Katram atšķaidījumam un katrai šūnu līnijai izmanto vismaz 2 cm2 šūnu platības, kas atbilst vienai 24 iedobju šūnu kultūras plates iedobei. Ja vien iespējams, izmanto šūnu kultūras plates.

5.3. Šūnu kultūru inkubēšana

Inokulētās šūnu kultūras 7 līdz 10 dienas inkubē 15 °C temperatūrā. Ja novēro barotnes paskābināšanos (barotnei ar šūnu kultūru krāsa mainās no sarkanas uz dzeltenu), ar sterilu bikarbonāta šķīdumu vai ar līdzvērtīgām vielām koriģē barotnes pH, lai nodrošinātu, ka šūnas joprojām ir uzņēmīgas pret vīrusa infekciju.

Vismaz vienu reizi sešos mēnešos vai tad, ja ir aizdomas par šūnu uzņēmīguma samazināšanos, saldētās virālās hemorāģiskās septicēmijas vīrusa vai infekciozās hematopoētiskās nekrozes vīrusa kultūras titrē, lai pārliecinātos par šūnu kultūru uzņēmību pret infekciju. Ja iespējams, izmanto šī pielikuma III. nodaļā aprakstīto procedūru.

5.4. Mikroskopija

Inokulētajām šūnu kultūrām ne retāk kā trīs reizes nedēļā 40 līdz 150 reižu palielinājumā apskata, vai nav radies CPE. Ja novēro nepārprotamu CPE nekavējoties saskaņā ar šīs nodaļas 6. punktā noteikto kārtību sāk vīrusa identificēšanas procedūras.

5.5. Šūnu pārsēšana

Ja pēc 7 līdz 10 dienas ilgas primārās inkubēšanas CPE nav radies, kultūru pārsēj uz jaunām šūnu kultūrām, izmantojot tādu pašu šūnu platību kā primārajai kultūrai.

Kad pagājušas 7 līdz 10 dienas pēc inokulēšanas, pa šūnu līnijām kopo visu primāro kultūru veidojošo kultūru vai iedobju barotnes (centrifugāta) alikvotas. Šos kopotos paraugus, kā aprakstīts šīs nodaļas 5.2. apakšpunktā, neatšķaidītā veidā un atšķaidījumā 1:10 (iegūstot galīgos centrifugāta atšķaidījumus, attiecīgi 1:10 un 1:100) inokulē homoloģiskās šūnu kultūrās. Atļauts primārās kultūras barotnes desmitprocentīgas alikvotas inokulēt tieši iedobē ar jaunu šūnu kultūru (pārsēšana no iedobes iedobē). Pirms atšķaidījumus inokulēt, tos, kā aprakstīts šīs nodaļas 4.3. apakšpunktā, var iepriekš inkubēt ar infekciozās pankreātiskās nekrozes vīrusa antiserumu attiecīgā atšķaidījumā. Inokulētās kultūras 7 līdz 10 dienas inkubē 15 °C temperatūrā un apskata saskaņā ar šīs nodaļas 5.4. apakšpunktu.

Ja toksisks CPE rodas pirmajās trijās inkubēšanas dienās, šūnas pārsēj šajā posmā, pēc tam 7 dienas inkubē, atkal pārsēj un turpmāk septiņas dienas inkubē. Ja toksisks CPE rodas vēlāk nekā pēc trim dienām, šūnām var veikt vienu pasāžu un tās inkubēt tā, lai no pirmās inokulēšanas kopā būtu 14 dienas. Pēdējās septiņās inkubēšanas dienās nekādu toksicitātes pazīmju nedrīkst būt.

Ja, neskatoties uz to, ka ir veikta apstrāde ar antibiotikām, rodas bakteriāla kontaminācija, pirms pārsēšanas 15 līdz 30 minūtes 2 līdz 5 °C temperatūrā veic centrifugēšanu 2000 līdz 4000 x apgriezieni /minūtē vai centrifugāta filtrēšanu ar 0,45 μm filtru vai abas šīs darbības (membrāna ar zemu olbaltumvielu saistīšanas spēju). Turklāt pārsēšanā ievēro tās pašas procedūras, kas attiecībā uz toksisku CPE aprakstītas šā punkta ceturtajā daļā.

Ja CPE nerodas, testa rezultātu var paziņot par negatīvu.

6. Vīrusa identificēšana

Ja novērojumi liecina, ka šūnu kultūrā ir CPE, ievāc barotni (centrifugātu) un pārbauda ar vienu vai vairākiem šādiem paņēmieniem: imūnfermentatīvā analīze (ELISA), imūnfluorescence (IF), neitralizācija, RT-PCR vai RT-qPCR. Ja ar šiem testiem vienas nedēļas laikā vīrusu nav bijis iespējams galīgi identificēt, centrifugāt nekavējošai identifikācijai nosūta uz citu Eiropas Savienības references laboratoriju.

6.1. ELISA

Vīrusa izolāta identificēšanai izdara divslāņu ELISA ar divām antivielām. Mikrotitrēšanas platēs uzklāj pārklājumu, daudzumā 50 μl uz iedobi (0,9 pg) iepilinot no truša antiseruma pret virālās hemorāģiskās septicēmijas vīrusu vai infekciozās hematopoētiskās nekrozes vīrusu iegūtu pierādītas kvalitātes attīrītu A proteīna imūnglobulīnu (Ig) karbonāta buferšķīdumā (pH 9,6) ar nātrija azīda saturu 15 mM, un no 18 stundām līdz 2 nedēļām inkubē 4 °C temperatūrā.

Šķīdumu platē katru paraugu, kas satur 1 % Triton X-100, un pozitīvos kontrolparaugus atšķaida ar buferšķīdumu (liellopu seruma albumīnu fosfātu fizioloģiskajā buferšķīdumā PBS-T, BSA 1 %) četros atšķaidījumos: neatšķaidīts, 1:4, 1:16, 1:64. ELISA plates skalo fosfātu fizioloģiskajā buferšķīdumā, kas satur 0,05 % Tween-20 (PBS-T), un noskalotajā un ar pārklājumu klātajā ELISA platē ievada 50 µl no katras šķīdumu plates šķīdumu koncentrācijas.

Pēc tam ELISA plates 30 minūtes inkubē 37 °C temperatūrā. Tad plates skalo un 30 minūtes 37 °C temperatūrā inkubē ar specifiskām monoklonālajām antivielām (konkrētāk, virālās hemorāģiskās septicēmijas vīrusa identificēšanai ar MAb IP5B11 un infekciozās hematopoētiskās nekrozes vīrusa identificēšanai attiecīgi ar Hyb 136-3). ELISA platē pievieno 50 µl truša pretpeles antivielas mārrutku peroksidāzes konjugāta atšķaidījumā ar PBS-T-BSA 1:1000.

Pēc atkārtotas skalošanas ierosina reakcijas, katrā iedobē pievienojot 50 μl ortofenilēndiamīna (OPD). ELISA plates tumsā istabas temperatūrā inkubē 20 minūtes, un reakciju apstādina, katrā iedobē pievienojot 100 μl 0,5 M H2SO4.

ELISA lasāmierīcē monitorē absorbenci viļņa garumiem 492 un 620 nm. Pēc testa rezultātu salīdzināšanas ar pozitīvo un negatīvo kontroļu absorbences vērtībām paraugus apzīmē kā pozitīvus vai negatīvus. Kopumā paraugus, kam neatšķaidītam materiālam kopējā absorbence (A) < 0,5, uzskata par negatīviem, paraugus ar A vērtībām no 0,5 līdz 1,0 uzskata par aizdomīgiem un paraugus, kam A > 1,0, uzskata par pozitīviem.

Šajā punktā minēto ELISA variantu vietā var izmantot citus ar pierādītu līdzvērtīgu rezultativitāti.

6.2. Imūnfluorescence - IF

Virālās hemorāģiskās septicēmijas un infekciozās hematopoētiskās nekrozes vīrusus identificē:

- inficējot šūnas 96 iedobju "Black" platēs;

- inficējot šūnas parastajās 24 iedobju platēs vai uz 24 iedobju plates segstikliem.

Ja virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes vīrusus vai tos abus identificē, inficējot šūnas uz segstikliem, rīkojas pēc šāda protokola:

(a) segstikliem uzsēj šūnas tādā blīvumā, lai pēc 24 stundu kultivēšanas būtu 60 % līdz 90 % konfluence. Ja iespējams, šajā nolūkā ieteicamas EPC šūnas, jo tās stingri pielīp stikla virsmām, tomēr tikpat labi var izmantot citas šūnu līnijas - tādas kā BF-2, RTG-2 vai FHM. 150 μl šūnu kultūras centrifugāta divos dažādos atšķaidījumos (1:10 un 1:1000) dublikātā inokulē vienu dienu vecos monoslāņos un 24 stundas inkubē 15 °C temperatūrā;

(b) pēc tam barotni ar šūnu kultūru izņem un inficētos šūnu monoslāņus fiksē ar 0,5 ml ledusauksta acetona ūdens šķīduma (80 % tilpumkoncentrācija). Fiksāciju 15 minūtes istabas temperatūrā veic velkmes skapī, pēc tam no acetona šķīduma atbrīvojas un segstikliņus vismaz 30 minūtes žāvē ar gaisu. Šajā posmā plates vai nu nekavējoties apstrādā, vai - 20 °C temperatūrā glabā turpmākai lietošanai;

(c) specifiskas monoklonālas antivielas (konkrētāk, virālās hemorāģiskās septicēmijas vīrusa identificēšanai MAb IP5B11, savukārt infekciozās hematopoētiskās nekrozes vīrusa identificēšanai attiecīgi Hyb 136-3) atšķaida 0,01 M PBST ar pH 7,2 tādā atšķaidījumā, kā ieteic MAb piegādātājs; fiksētajam monoslānim pievieno 50 līdz 100 μl uz iedobi, un plates mitrā kamerā vienu stundu inkubē 37 °C temperatūrā;

(d) segstikliņus trīs reizes saudzīgi skalo ar 0,05 % Tween-20 saturošu fosfātu buferšķīdumu (PBS-T) un pēc pēdējās skalošanas no visa buferšķīduma atbrīvojas. Pēc tam šūnas vienu stundu inkubē 37 °C, par primāro antivielu lietojot peļu imūnglobulīna antivielu konjugātu fluorescīna izotiocianātā (FITC) vai tetrametilrodamīna-5-(un-6-) izotiocianātā (TRITC), saskaņā ar piegādātāja norādījumiem atšķaida, atkal skalo PBS-T un nožāvē. Iekrāsotās kultūras novieto uz priekšmetstikliņiem, izmantojot glicerīna sālsūdens šķīdumu, un pārbauda krītošā ultravioletā (UV) gaismā. Izmanto 10x un 12x okulārus un 25x vai 40x objektīva lupu ar skaitlisko apertūru attiecīgi < 0,7 un < 1,3.

Alternatīvi attiecībā uz šūnu kultūrām, fiksēšanu un standartkvalitātes antivielām var lietot citus IF paņēmienus ar pierādītu līdzvērtīgu rezultativitāti.

6.3. Neitralizācija

No ievāktā centrifugāta, centrifugējot (2000 līdz 4000 x apgriezieniem/minūtē) vai filtrējot caur membrānas filtru (0,45 μm) ar zemu olbaltumvielu saistīšanas spēju, atdala šūnas, un centrifugātu barotnē ar šūnu kultūru atšķaida 1:100 un 1:10000.

Vismaz divu centrifugāta atšķaidījumu alikvotas atsevišķi sajauc ar vienādām turpmāk minēto reaģentu daļām un pēc tam 60 minūtes inkubē 15 °C temperatūrā:

a) serums, kas satur specifiskas grupas antivielas pret virālās hemorāģiskās septicēmijas vīrusu atšķaidījumā 1:50 (tilpumkoncentrācija);

b) serums, kas satur specifiskas grupas antivielas pret infekciozās hematopoētiskās nekrozes vīrusu atšķaidījumā 1:50 (tilpumkoncentrācija);

c) kopots antiserums pret vietējiem infekciozās pankreātiskās nekrozes vīrusa serotipiem atšķaidījumā 1:50 (tilpumkoncentrācija);

d) tikai barotne (pozitīvais kontrolparaugs).

Katram vīrusa centrifugāta un seruma maisījumam inokulē vismaz divas šūnu kultūras, katru ar 50 μl, un pēc tam inkubē 15 °C temperatūrā. Ņemot vērā šīs nodaļas 5.4. apakšpunktā noteiktos raksturlielumus, pārliecinās, vai nerodas CPE.

Virālās hemorāģiskās septicēmijas vīrusu celmus un izolātus, kas nereaģē neitralizācijas testos, identificē ar IF vai ar ELISA.

Alternatīvi var izmantot citus neitralizācijas testus ar pierādītu līdzvērtīgu rezultativitāti.

6.4. RT-PCR/RT-qPCR

6.4.1. Vīrusu RNS sagatavošana

Visas darbības ar RNS veic cimdos uz ledus.

Ribonukleīnskābes ekstrahē ar fenola–hloroforma metodi vai ar ribonukleīnskābes afinitātes rotācijas stobriņiem saskaņā ar ražotāja norādījumiem. Drīkst izmantot tirdzniecībā pieejamos RNS ekstrahēšanas komplektus, ar kuriem iegūstama augsti kvalitatīva RNS, kas piemērota izmantošanai turpmāk aprakstītajos RT-PCR protokolos.

Ribonukleīnskabes atkārtoti suspendē destilētā no ribonukleāzes brīvā ūdenī (proti, ar 0,1 % dietilpirokarbonātu apstrādātā ūdenī) vai piemērotā eluēšanas buferšķīdumā.

6.4.2. RT-PCR

Infekciozās hematopoētiskās nekrozes vīrusa konstatēšanai izmanto šādus praimerus:

tiešais praimeris: 5’-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3’;

atgriezeniskais praimeris: 5’-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3’.

Izmanto šādus ciklus (viensoļa RT-PCR): 1 cikls: 50 °C 30 min; 1 cikls: 95 °C 2 min; 30 cikli: 95 °C 30 sekundes, 50 °C 30 sekundes, 72 °C 60 sekundes; 1 cikls: 72 °C 7 min un mērcēšana 4 °C temperatūrā.

Virālās hemorāģiskās septicēmijas vīrusa konstatēšanai izmanto šādus praimerus:

VN tiešais: 5’-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3’;

VN atgriezeniskais: 5’-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3’.

Izmanto šādus ciklus (viensoļa RT-PCR): 50 °C 30 min, 95 °C 15 min, 35 cikli ar 94 °C 30 sekundes, 55 °C 30 sekundes, 68 °C 60 sekundes. Pēc tam 68 °C temperatūrā 7 minūtes ļauj notikt reakcijai.

RT-PCR reakciju daudzumu un specifiskumu izvērtē ar gela elektroforēzi 1,5 % agarozes gelā ar etīdija bromīdu un novēro ultravioletajā caurgaismošanā. Attiecībā uz infekciozās hematopoētiskās nekrozes vīrusu var novērot PCR amplikonu 693 bp. Attiecībā uz virālās hemorāģiskās septicēmijas vīrusu šis lielums ir 505 bp.

PCR rezultāti var variēt atkarībā no tās izpildīšanas apstākļiem, proti, atkarībā no izmantotā dezoksiribonukleīnskābes (turpmāk – DNS) amplifikatora var būt nepieciešams optimizēt amplificēšanas protokolus. Nepareizas praimeru hibridizācijas vai laboratoriskas kontaminācijas dēļ var tikt iegūti viltus pozitīvi rezultāti. Tāpēc, lai novērstu jebkādas šaubas, ir jāiekļauj pietiekami pozitīvie un negatīvie kontrolparaugi un sekvenēšanas amplikoni. Attiecībā uz virālās hemorāģiskās septicēmijas vīrusa praimeriem īpaši uzmanīgi jārīkojas ar BF-2 šūnām, jo praimeri var reaģēt ar šūnu līnijas DNS/RNS, dodot līdzīga izmēra viltuspozitīvu rezultātu. Testējot no BF-2 šūnām iegūtu centrifugātu, visi amplificētie PCR fragmenti jāsekvenē.

6.4.3. RT-qPCR virālās hemorāģiskās septicēmijas vīrusa noteikšanai

Virālās hemorāģiskās septicēmijas vīrusa noteikšanai amplificēšanu veic ar šādiem praimeriem un provi:

tiešais praimeris: 5’-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3’,

atgriezeniskais praimeris: 5’-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3’

un prove: 5’-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.

Viensoļa RT-PCR

Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Ciklēšanas nosacījumi: 50 °C 30 min, 95 °C 15 min, 40 cikli ar 94 °C 15 s, 60 °C 40 s, 72 °C 20 s; ja nepieciešams, koriģē. Aprakstītā varianta vietā var izmantot citus RT-PCR vai RT-qPCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

6.4.4. RT-qPCR IHNV noteikšanai

Infekciozās hematopoētiskās nekrozes vīrusa noteikšanai amplificēšanu veic ar šādiem praimeriem un provi:

tiešais praimeris: 5’- AGA-GCC-AAG-GCA-CTG-TGC-G-3’,

atgriezeniskais praimeris: 5’- TTCTTTGCGGCTTGGTTGA – 3’

un prove: 5’ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.

Divsoļu RT-qPCR

Turpmāk minētais tests ir atkarīgs no divsoļu amplifikācijas. Lai nenotiktu kontaminēšanās, ar abu reakciju mēģenēm rīkojas ļoti piesardzīgi.

Ciklēšanas nosacījumi (pēc RT soļa): 50 °C 2 min, 95 °C 10 min, 40 cikli ar 95 °C 15 sekundes un 60 °C 1 min. (ja nepieciešams, koriģē).

Aprakstītā varianta vietā var izmantot citus RT-PCR vai RT-qPCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

II. Laboratoriskās diagnostikas metodes slimības diagnozes apstiprināšanai vai aizdomu izslēgšanai par inficēšanos ar virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes vīrusu

1. Parastā vīrusa izolēšana ar tai sekojošu vīrusa identificēšanu

1.1. Izmeklēšanai ņem vismaz 10 zivis, kam vērojamas tipiskas virālās hemorāģiskās septicēmijas vai infekciozās hematopoētiskās nekrozes pazīmes.

1.2. Zivju paraugu sagatavošanā un nosūtīšanā, ko veic parastās vīrusa izolēšanas vajadzībām, ievēro šī pielikuma I. nodaļas 2. punktā noteiktās metodes un procedūras.

1.3. Papildu diagnostiskā materiāla vākšanā, ko veic parastās vīrusa izolēšanas vajadzībām, ievēro šī pielikuma I. nodaļas 3. punktā noteiktās metodes un procedūras.

1.4. Paraugu sagatavošanā šūnu kultūras izmeklēšanai, ko veic parastās vīrusa izolēšanas vajadzībām, ievēro šī pielikuma I. nodaļas 4. punktā noteiktās metodes un procedūras.

1.5. Šūnu kultūru virusoloģiskajā izmeklēšanā, ko veic parastās vīrusa izolēšanas vajadzībām, ievēro šī pielikuma I. nodaļas 5. punktā noteiktās metodes un procedūras.

1.6. Vīrusa identificēšanā, ko veic parastās vīrusa izolēšanas vajadzībām, ievēro šī pielikuma I. nodaļas 6. punktā noteiktās metodes un procedūras.

2. Vīrusa konstatēšana ar RT-qPCR

2.1. Paraugu ņemšanā, ko veic, lai konstatētu vīrusus ar RT-qPCR, ievēro šī pielikuma I. nodaļas 1.2. punktā noteiktās metodes un procedūras.

2.2. Zivju paraugus vīrusu konstatēšanai ar RT-qPCR sagatavo un nosūta, ievērojot šī pielikuma I. nodaļas 2. punktā noteiktās metodes un procedūras.

2.3. Papildu diagnostiskā materiāla ievākšanā, ko veic, lai konstatētu vīrusus ar RT-qPCR, ievēro šī pielikuma I. nodaļas 3. punktā noteiktās metodes un procedūras.

2.4. Paraugu sagatavošanā, ko veic, lai konstatētu vīrusus ar RT-qPCR, ievēro šī pielikuma I. nodaļas 6.4.1. apakšpunktā noteiktās metodes un procedūras.

2.5. Vīrusa konstatēšanā ar RT-qPCR ievēro šī pielikuma I. nodaļas 6.4.1., 6.4.3. un 6.4.4. apakšpunktā noteiktās metodes un procedūras.

3. Citi diagnostiskie paņēmieni

Saskaņā ar šī pielikuma I. nodaļas 4.3. apakšpunkta aprakstu pagatavoto centrifugātu var iesniegt ELISA testam, netiešās imūnfluorescences antivielu testam (IFAT) vai RT-PCR attiecīgi saskaņā ar šī pielikuma I. nodaļas 6.1., 6.2. vai 6.4. apakšpunktu. Audu materiālam var izmantot citus diagnostiskus paņēmienus, piemēram, sasaldētiem griezumiem – netiešo fluorescējošo antivielu testu (IFAT) vai formalīnā fiksētam audu materiālam –imūnhistoķīmisko analīzi. Šos ātros paņēmienus 48 stundu laikā no paraugu ņemšanas papildina ar šīs nodaļas 1. vai 2. punktam atbilstošu virusoloģisku izmeklēšanu, ja:

a) iegūts negatīvs rezultāts vai

b) ar materiālu, kas ņemts no pirmā infekciozās hametopoētiskās nekrozes vai virālās hemorāģiskās septicēmijas gadījuma audiem, iegūts pozitīvs rezultāts.

III. Titrēšanas procedūras kārtība šūnu kultūru uzņēmības konstatēšanai pret inficēšanos

Veicot šī pielikuma I. nodaļas 5.3. apakšpunktā minēto titrēšanu, kurā pārliecinās par šūnu kultūru uzņēmību pret inficēšanos, ievēro turpmāk aprakstītās procedūras.

Izmanto vismaz divus virālās hemorāģiskās septicēmijas vīrusa izolātus un vismaz vienu infekciozās hematopoētiskās nekrozes vīrusa izolātu. Izolāti pārstāv nozīmīgāko vīrusu grupu Eiropas Savienībā, proti, attiecībā uz virālās hemorāģiskās septicēmijas vīrusu viens patogēnisks izolāts, kas saldūdenī iegūts no varavīksnes foreles, un viens patogēnisks izolāts, kas jūras ūdenī iegūts no akmeņplekstes, bet attiecībā uz infekciozās hematopoētiskās nekrozes vīrusu - viens patogēnisks celms, kas Eiropas Savienībā iegūts no varavīksnes foreles. Izmanto Eiropas Savienības dalībvalstīs iegūtus izteiktus izolātus. Virālās hemorāģiskās septicēmijas vīrusam šūnu kultūrkolbās ar maziem šūnu kultūras pasāžas skaitļiem pavairo BF-2 vai RTG-2 līnijas partijas, savukārt infekciozās hematopoētiskās nekrozes vīrusam - EPC vai FHM līnijas partijas. Izmanto tādu barotni ar šūnu kultūru, kas satur vismaz 10 % seruma. Inokulēšanai izmanto zemu inficētspējas multiplicitāti (MOI) (< 1).

Kad iestājies pilnīgs CPE, šūnu kultūras centrifugātu 15 minūtes centrifugējot ar 2000 x apgriezieniem/minūtē, ievāc vīrusu, sterilizē caur 0,45 μm membrānas filtru un sadala pa etiķetētām kriomēģenēm. Vīrusu glabā −80 °C temperatūrā.

Nedēļu pēc sasaldēšanas trīs replicētas mēģenes ar katru vīrusu zem auksta ūdens atkausē un titrē pa to attiecīgajām šūnu līnijām. Katru vīrusa izolātu atkausē un titrē vismaz reizi sešos mēnešos vai tad, ja ir aizdomas, ka ir samazinājies šūnu līnijas uzņēmīgums.

Titrēšanas procedūrām jābūt detalizēti aprakstītām un katrreiz jāievēro viena un tā pati procedūra.

Titrēšanā pēc beigu punkta atšķaidījuma katrā atšķaidījuma solī izmanto vismaz sešus replicētus paraugus. Titrus salīdzina ar iepriekš iegūtiem titriem. Ja jebkuram no trim vīrusu izolātiem salīdzinājumā ar sākotnējo titru tas samazinās par koeficientu 2 log vai vairāk, šūnu līniju uzraudzībā vairs neizmanto.

Ja laboratorijā tur dažādas šūnu līnijas, atsevišķi pārbauda katru līniju.

Laboratorijā pierakstus par diagnostiskajiem izmeklējumiem glabā ne mazāk kā 10 gadus.

IV. Laboratoriskās diagnostikas metodes slimības diagnozes apstiprināšanai vai aizdomu izslēgšanai par inficēšanos ar Koiju herpesvīrusa slimības vīrusu

1. Zivju paraugu sagatavošana

Diagnostiskiem nolūkiem nosūtīt un testēšanai ar parastajām uz PCR vai qPCR bāzētām metodēm izmantot var dzīvas vai nonāvētas un atsevišķi hermētiskās aseptiskās tvertnēs iepakotas zivis vai, alternatīvi, sasaldētus orgānus vai orgānu gabalus, kas konservēti 80 līdz 100 % spirtā vai vīrusu transporta barotnē (apstrādāšanai 48 stundu laikā no ievākšanas brīža).

Koiju herpes vīrusa konstatēšanai ievāc žaunas un nieres. Nodalītā papildu paraugā var iekļaut liesu, galvas smadzenes un zarnas. Akūtos gadījumos audu materiālu var kopot no ne vairāk kā piecām zivīm.

Noteiktos gadījumos (piemēram, ja ir aizdomas par KHV) var izmantot neletālus paraugus, piemēram, asinis, uztriepes no žaunām, žaunu biopsiju, gļotādu noskrāpējumus. Tā var rīkoties ar ļoti vērtīgām zivīm.

1.1. Dezoksiribonukleīnskābes ekstrahēšana

DNS ekstrahē saskaņā ar standartprocedūrām.

Drīkst izmantot tirdzniecībā pieejamos DNS ekstrahēšanas komplektus, ar kuriem iegūstama augsti kvalitatīva DNS, kas piemērota izmantošanai šīs nodaļas 2. punktā minētajos PCR protokolos.

2. Ierosinātāju konstatēšana un identificēšana ar metodēm, kuru pamatā ir polimerāzes ķēdes reakcija (PCR)

2.1. qPCR KHV konstatēšanai

Koiju herpes vīrusa konstatēšanai ar qPCR izmanto šādu qPCR testu:

tiešais praimeris (KHV-86f): 5’- GACGCCGGAGACCTTGTG -3’,

atgriezeniskais praimeris (KHV-163r): 5’- CGGGTTCTTATTTTTGTCCTTGTT -3’

un prove (KHV-109p): 5’-FAM- CTTCCTCTGCTCGGCGAGCACG -3’.

Ciklēšanas nosacījumi: viens cikls ar 95 °C 15 min, kam seko 40 cikli ar 94 °C 15 sekundes un 60 °C 60 sekundes. Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Tomēr aprakstītā varianta vietā var izmantot citus qPCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

2.2. Parastā PCR KHV konstatēšanai

Izmanto šajā punktā aprakstīto testu, kurā mērķgēns ir koiju herpes vīrusa timīna kināzes (TK) gēns. Tomēr aprakstītā varianta vietā var izmantot citus PCR testus, kuriem ir pierādīts aprakstītajam testam līdzvērtīgs jutīgums un specifiskums.

Tiešais praimeris (KHV-TKf): 5'-GGGTTACCTGTAC GAG-3';

atgriezeniskais praimeris (KHV-TKr): 5'-CACCCAGTAGATTA TGC-3'.

Ciklēšanas nosacījumi: viens cikls ar 95 °C 5 min, pēc tam 35 cikli ar 95 °C 30 sekundes, 52 °C 30 sekundes, 72 °C 1 min un viens cikls ar 72 °C 10 min. Iegūtā produkta izmēram vajadzētu būt 409 bp.

PCR rezultāti var variēties atkarībā no tās izpildīšanas apstākļiem, proti, atkarībā no izmantotā DNS amplifikatora var būt nepieciešams optimizēt amplificēšanas protokolus. Nepareizas praimeru hibridizācijas vai laboratoriskas kontaminācijas dēļ var tikt iegūti viltus pozitīvi rezultāti. Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Tomēr aprakstītā varianta vietā var izmantot citus PCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

Pirmo konstatāciju kādā teritorijā vai nu apstiprina ar sekvenēšanas metodi, vai vīrusa tūlītējai identificēšanai nosūta uz Latvijas valsts references laboratoriju vai citu Eiropas Savienības dalībvalstu references laboratoriju.

V. Laboratoriskās diagnostikas metodes Koiju herpes vīrusa slimības uzraudzībai

Šajā nodaļā noteikto paraugu ņemšanu un laboratorisko izmeklēšanu veic, lai audzētava iegūtu vai saglabātu veselības stāvokli "infekcijas slimības neskarts" attiecībā uz koiju herpes vīrusa slimību.

1. Zivju paraugu sagatavošana

Paraugus ņem šādā kārtībā:

- no zivīm, kas ilgāku laiku turētas tādu temperatūru diapazonā, kurās iespējama koiju herpes vīrusa attīstīšanās, proti, divas līdz trīs nedēļas 15 °C līdz 26 °C temperatūrā;

- ievāc 24 stundas, taču ne vēlāk kā 72 stundas pēc tam, kad piekopta tāda saimniekošanas prakse, piemēram, tīklošana vai pārvadāšana, kuras rezultātā tādu zivju organismā, kam ir nēsātāja statuss, vīruss varētu no jauna aktivizēties.

Koiju herpes vīrusa slimības uzraudzības nolūkiem var nosūtīt un testēšanai ar metodēm, kuru pamatā ir PCR, izmantot dzīvas vai nonāvētas un atsevišķi hermētiskās aseptiskās tvertnēs iepakotas zivis vai, alternatīvi, sasaldētus orgānus vai orgānu gabalus, kas konservēti 80 līdz 100 % spirtā vai vīrusu transporta barotnē (apstrādāšanai 48 stundu laikā no ievākšanas). Koiju herpes vīrusa slimības uzraudzībai ievāc žaunu un nieru audus.

Koiju herpes vīrusa slimības uzraudzības nolūkā iespējami izvairās no kopotiem paraugiem. Ja nepieciešami kopoti paraugi, kopot atļauts ne vairāk kā divu zivju audu materiālu. Lielākus paraugus homogenizē miezerī ar piestu vai ar homogenizatoru Stomacher un pirms dzidrināšanas paņem apakšparaugus DNS ekstrahēšanai. Var rīkoties arī tā, ka no katriem paraugā iekļautajiem audiem ievāc apakšparaugu, ko ievieto lizēšanas mēģenēs.

1.1. DNS ekstrahēšana

DNS ekstrahē saskaņā ar standartprocedūrām. Drīkst izmantot tirdzniecībā pieejamos DNS ekstrahēšanas komplektus, ar kuriem iegūstama augsti kvalitatīva DNS, kas piemērota izmantošanai šīs nodaļas 2. punktā aprakstītajos PCR protokolos.

Pieņemama audu un barotnes attiecība ir masa/tilp. 1:9. Testus veic ar 20 līdz 25 mg audu materiāla.

2. Koiju herpes vīrusa slimības uzraudzīšana ar metodēm, kuru pamatā ir PCR

Koiju herpes vīrusa uzraudzībai izmanto qPCR. Ja teritorijā, kas agrāk nav apstiprināta par pozitīvu, parādās pozitīvi paraugi, testu rezultātus apstiprina vai nu arPCR vai divsoļu atgriezeniskās transkriptāzes PCR galaproduktu sekvencēšanas metodi.

Iegūtajai tīrajai konsensa sekvencei vismaz par 98 % jāatbilst etalonsekvencēm, vai ja tā tas nav, paraugus nosūta uz Latvijas valsts references laboratoriju apstiprināšanai.

2.1. qPCR koiju herpes vīrusa konstatēšanai

qPCR izmanto atbilstoši šādam aprakstam:

tiešais praimeris (KHV-86f): 5’- GACGCCGGAGACCTTGTG -3’,

atgriezeniskais praimeris (KHV-163r): 5’- CGGGTTCTTATTTTTGTCCTTGTT -3’

un prove (KHV-109p): 5’-FAM- CTTCCTCTGCTCGGCGAGCACG -3’.

Ciklēšanas nosacījumi: viens cikls ar 95 °C 15 min, kam seko 50 cikli ar 94 °C 15 sekundes un 60 °C 60 sekundes.

qPCR rezultāti var variēties atkarībā no tās izpildīšanas apstākļiem, proti, atkarībā no izmantotā DNS amplifikatora var būt nepieciešams optimizēt amplificēšanas protokolus. Nepareizas praimeru hibridizācijas vai laboratoriskas kontaminācijas dēļ var tikt iegūti viltus pozitīvi rezultāti. Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Tomēr aprakstītā varianta vietā var izmantot citus qPCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

2.2. Parastā PCR koiju herpes vīrusa apstiprināšanai

Lai apstiprinātu koiju herpes vīrusa slimības klātbūtni, izmanto turpmāk norādītajā tabulā aprakstīto parasto divsoļu atgriezeniskās transkriptāzes PCR, pēc kuras iegūto amplificēto materiālu sekvenē.

Koiju herpes vīrusa slimības apstiprināšana

N.p.k. Praimeri un nosacījumi divsoļu atgriezeniskās transkriptāzes PCR testam, kurā mērķvīrusi ir visi karpu dzimtas herpesvīrusi (CyHV-1, CyHV-2 un CyHV-3) Praimera nosaukums Sekvence Ciklēšanas nosacījumi Produkta izmērs
1. CyHVpol-tiešais 5'-CCAGCAACATGTGCGACGG-3' PCR pirmais raunds

1 ciklu:

95 °C, 2 min

40 ciklus:

95 °C, 30 s

55 °C, 30 s

72 °C, 45 s

1 ciklu:

72 °C, 10 min

362 bp
2. CyHVpol-iekšējais tiešais 5'-CGACGGVGGYATCAGCCC-3' PCR otrais raunds

1 ciklu:

95 °C, 2 min

40 ciklus:

95 °C, 30 s

55 °C, 30 s

72 °C, 45 s

1 ciklu:

72 °C, 10 min

339 bp
3. CyHVpol-iekšējais atgriezeniskais 5'-GAGTTGGCGCAYACYTTCATC-3'    

PCR rezultāti var variēt atkarībā no tās izpildīšanas apstākļiem, proti, atkarībā no izmantotā DNS amplifikatora var būt nepieciešams optimizēt amplificēšanas protokolus. Turklāt nepareizas praimeru hibridizācijas vai laboratoriskās kontaminācijas dēļ var tikt iegūti viltus pozitīvi rezultāti. Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Aprakstītā varianta vietā var izmantot citus PCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

Sekvenēšanu var veikt laboratorija vai sekvenēšanā specializējušās ārpakalpojumu firmas. Sekvenēšanas rezultātus analizē, sekvences salīdzinot ar zināmām koiju herpes vīrusa etalonsekvencēm (Gen Bank piekļuves numuri AP008984, DQ657948 un DQ177346). Iegūtajai tīrajai konsensa sekvencei vismaz par 98 % jāatbilst minētajām etalonsekvencēm.

VI. Paraugu ņemšanas kārtība par lašu infekciozās anēmijas apstiprināšanu vai aizdomu izslēgšanai par inficēšanos ar lašu infekciozās anēmijas vīrusu

1. Zivju paraugu sagatavošana

Laboratoriskiem izmeklējumiem attiecībā uz lašu infekciozās anēmijas klātbūtni, ja ir iespējams, zivju paraugus nekopo. Tomēr ir pieņemami kopot 2 līdz 5 zivis lašu infekciozās anēmijas uzraudzības vajadzībām.

No visām zivīm, no kurām ņemti paraugi, ievāc paraugus apgrieztās transkriptāzes polimerāzes ķēdes reakcijas analīzei (RT-PCR). No zivs ar sterilu instrumentu izņem vidusnieres gabaliņu un to ievieto mikrocentrifūgas mēģenē, kur iepildīts RNS konservēšanas šķīdums (1 ml), kura lietderīgums ir pierādīts. Audus vienā mēģenē ar transporta šķīdumu var ievākt no ne vairāk kā piecām zivīm, un tie veido vienu kopotu paraugu. Viena parauga audu svaram jābūt 0,5 g. Ja zivis ir pārāk mazas, vajadzīgā parauga svara iegūšanai var nosauktajā secībā paņemt nieru, sirds, liesas, aknu vai vārtnieka aklās zarnas gabaliņus, lai iznākumā svars būtu 0,5 g.

Audus histoloģiskai izmeklēšanai ņem tikai no nesen nonāvētām zivīm ar normālu miesasbūvi, kurām novēro lašu infekciozai anēmijai atbilstošas klīniskās pazīmes vai pēcnāves izmeklēšanas rezultātus. Ņem visu ārējo vai iekšējo bojājumu paraugus un no atsevišķām zivīm visos gadījumos ar skalpeļa palīdzību ņem vidusnieres, sirds, aknu, aizkuņģa dziedzera, zarnu, žaunu un liesas paraugus, ko ievieto 8–10 % tilpumkoncentrācijas fizioloģiskajā formalīna buferšķīdumā. Lai audi pietiekami labi saglabātos, fiksatīva un audu attiecībai jābūt vismaz 20:1. Imūnķīmiskajai analīzei (IHC) ņem vidusnieres un sirds paraugus.

No visām paraugu ņemšanai paredzētām zivīm ņem audus virusoloģiskai izmeklēšanai šūnu kultūrā. Ar sterilu instrumentu no zivīm ņem aknu, galvasnieres vai vidusnieres, sirds un liesas gabaliņus, un tos ievieto plastmasas mēģenēs, kurās iepildīti 9 ml transporta barotnes. Audus no ne vairāk kā piecām zivīm var ievākt vienā mēģenē ar transporta šķīdumu, un tie veido vienu kopotu paraugu. Viena parauga audu svaram jābūt 1,0 ± 0,5 g.

2. Zivju paraugu nosūtīšana

Ja pārvadāšanas laikā iespējams ievērot šīs nodaļas 2. punkta trešajā atkāpē aprakstītās temperatūras prasības, uz laboratoriju var nosūtīt veselas zivis. Veselās zivis ietin absorbējošā papīrā un pārvadā plastikāta maisiņos, vēsumā, kā aprakstīts minētajā atkāpē.

Var sūtīt arī dzīvas zivis, taču tad transportēšana jāuzrauga zivju slimībās specializētajai Latvijas valsts references laboratorijai un jāņem vērā papildu dezinficēšanas un biodrošības problēmas, kas rodas dzīvu zivju transportēšanā.

Virusoloģiskai izmeklēšanai vai RT-PCR analīzei paredzētos asins paraugus un mēģenes ar zivju audiem ievieto izotermiskos konteineros (tādos kā polistirola kastes ar biezām sienām) kopā ar pietiekamu daudzumu ledus vai aukstumbloku, kas ceļā uz laboratoriju nodrošina paraugu dzesināšanu. Paraugus nedrīkst sasaldēt, bet pārvadāšanas kastē, to saņemot, joprojām jābūt ledum vai arī vienam vai vairākiem aukstumblokiem kas daļēji vai pilnīgi sasaluši. Ārkārtas apstākļos RT-PCR analīzei, kā arī virusoloģiskai izmeklēšanai paredzētos paraugus drīkst ātri sasaldēt un pārvest uz laboratoriju - 20 °C vai zemākā temperatūrā.

No RT-PCR analīzei paredzētiem audiem, ko glabā RNAlater, RNS atkarībā no paraugu glabāšanas temperatūras ekstrahē šādā laikā:

37 °C glabāti paraugi: viena diena,

25 °C glabāti paraugi: viena nedēļa,

4 °C glabāti paraugi: viens mēnesis,

- 20 °C glabāti paraugi: bez termiņa.

Ja zivju audi fiksatīvā jātransportē histoloģiskai izmeklēšanai, tie jānosūta hermētiskās mēģenēs triecienizturīgās tvertnēs. Šos paraugus nesasaldē.

Šūnu kultūras virusoloģisko izmeklēšanu sāk ne vēlāk kā 48 stundas pēc paraugu ievākšanas. Izņēmuma gadījumos, ja izmeklējamo materiālu aizsargā transporta barotne un ja pārvadāšanas laikā iespējams ievērot prasības attiecībā uz temperatūru, virusoloģisko izmeklēšanu var sākt vēlākais 72 stundas pēc materiāla ievākšanas.

3. Papildu diagnostiskā materiāla ievākšana

Ar nosacījumu, ka diagnostiskā laboratorija to ļauj, bez 1. punktā minētajiem ievākt un papildu izmeklēšanai sagatavot var vēl citus zivju audus.

VII. Laboratoriskās diagnostikas metodes slimības diagnozes apstiprināšanai vai aizdomu izslēgšanai par inficēšanos ar lašu infekciozās anēmijas vīrusu

1. Paraugu izmeklēšana ar RT-PCR

Lašu infekciozās anēmijas vīrusa skrīningam izmantotā diagnostikas metode ir RT-qPCR. Tā kā atkarībā no veikšanas apstākļiem RT-qPCR rezultāti var atšķirties, jebkādu šaubu novēršanai jāiekļauj pietiekami pozitīvie un negatīvie kontrolparaugi, un amplikoni.

1.1. Kopējās RNS ekstrahēšana

Visas darbības ar RNS veic cimdos uz ledus.

Kopējo RNS ekstrahē ar fenola-hloroforma metodi vai saskaņā ar ražotāja norādījumiem ar RNS afinitātes rotācijas stobriņiem.

Attīrītu RNS atkārtoti suspendē destilētā no ribonukleāzes brīvā ūdenī (proti, ar 0,1 % dietilpirokarbonātu apstrādātā ūdenī).

Ekstrahētās RNS koncentrāciju un tīrību novērtē, mērot optisko blīvumu pie 260 nm un pie 280 nm. Var arī izmantot iekšējus kontrolparaugus, kuros mērķsegments ir vīrusa genoms, kā minēts šīs nodaļas 1.3. apakšpunktā.

1.2. RT-PCR lašu infekciozās anēmijas vīrusa konstatēšanai

Lašu infekciozās anēmijas vīrusa genoma amplificēšanai var izmantot vairākas RT-PCR metodes. Var veikt divsoļu RT-PCR, kurā RT un PCR reakcijas soļus izpilda divās atsevišķās mēģenēs. Tomēr var veikt arī viensoļa reakciju, kurā abas reakcijas izpilda vienā mēģenē. Ja vien iespējams, izmanto viensoļa metodi, jo tad saturs nav jāpārvieto, tāpēc vienas mēģenes tests samazina krusteniskās kontaminācijas risku, turklāt to atzīst par tikpat jutīgu kā divsoļu metodi.

Izmanto šajā punktā aprakstītos praimerus un testu, proti, praimeru pāri ILA1 un ILA2, kuru mērķsegments ir 8. segments un kuri atzīti par piemērotiem lašu infekciozās anēmijas vīrusa konstatēšanai uzliesmojumu gadījumos un zivju vīrusa nēsātāju organismā. ILA2 atgriezeniskais praimeris neatbilst Ziemeļamerikas izolātiem, un tādos gadījumos izmanto alternatīvu praimeru komplektu.

Tiešais praimeris (ILA1): 5’-GGCTATCTACCATGAACGAATC-3’,

atgriezeniskais praimeris (ILA2): 5’-GCCAAGTGTAAGTAGCACTCC-3’.

Ciklēšanas nosacījumi: viens cikls ar 50 °C 30 min, viens cikls ar 94 °C 15 min, 40 cikli ar 94 °C 30 sekundes, 55 °C 30 sekundes, 72 °C 60 sekundes; viens cikls ar 72 °C 5 min. Iegūtā produkta izmērs 155 bp.

PCR rezultāti var variēties atkarībā no tās izpildīšanas apstākļiem, proti, atkarībā no izmantotā DNS amplifikatora var būt nepieciešams optimizēt amplificēšanas protokolus. Nepareizas praimeru hibridizācijas vai laboratoriskas kontaminācijas dēļ var tikt iegūti viltus pozitīvi rezultāti. Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Tomēr aprakstītā varianta vietā var izmantot citus RT-PCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

1.3. RT-qPCR lašu infekciozās anēmijas vīrusa konstatēšanai

Ar RT-qPCR iespējams panākt lielāku specifiskumu un, domājams, arī jutību. Ar šo metodi testu var izpildīt ātrāk, jo nav vajadzīgs gela elektroforēzes solis, turklāt tā mazina krusteniskās kontaminācijas risku, jo vīrusa genomiskās RNS daudzumu iespējams aplēst parauga mēģenē. RT-qPCR testam ir tāds trūkums, ka amplificētos produktus bieži vien nav iespējams sekvenēt. Tomēr, ja ir šaubas par amplificētā produkta specifiskumu, rezultāta apstiprināšanai jāizpilda vēl kāds lašu infekciozās anēmijas vīrusa specifisks tests.

Izmanto šajā punktā aprakstīto testu, kura mērķsegments ir 8. segments. Šis tests aptver Eiropas Savienības, Eiropas Brīvās tirdzniecības asociācijas un Ziemeļamerikas izolātus. Ja vien iespējams, izmanto viensoļa metodi, jo vienas mēģenes tests samazina krusteniskās kontaminācijas risku.

Tiešais praimeris: 5’- CTACACAGCAGGATGCAGATGT -3’,

atgriezeniskais praimeris: 5’- CAGGATGCCGGAAGTCGAT -3’

un prove: 5’-FAM- CATCGTCGCTGCAGTTC – MGBNFQ-3’.

Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Ciklēšanas nosacījumi: viens cikls ar 50 °C 30 min, viens cikls ar 95 °C 15 min, 40 cikli ar 94 °C 15 sekundes, 60 °C 60 sekundes; ja nepieciešams, koriģē. Aprakstītā varianta vietā var izmantot citus RT-PCR vai RT-qPCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

1.4. Amplificētu PCR produktu sekvenēšana

Tiešais praimeris (ILAs6-3F): 5’-ATGAGGGAGGTAGCATTGCA -3’;

atgriezeniskais praimeris (ILAs6-2R): 5’-CATGCTTTCCAACCTGCTAGGA -3’.

Katrā plašu atkārtojumā iekļauj negatīvus veidnes kontrolparaugus un pozitīvus kontrolparaugus. Ciklēšanas nosacījumi (viensoļa RT-PCR): viens cikls ar 50 °C 30 min, viens cikls ar 94 °C 15 min, 40 cikli ar 94 °C 30 sekundes, 55 °C 30 sekundes, 72 °C 60 sekundes, viens cikls ar 72 °C 5 min; ja nepieciešams, koriģē. Aprakstītā varianta vietā var izmantot citus RT-PCR vai RT-qPCR variantus ar pierādītu līdzvērtīgu rezultativitāti.

Alternatīvi HPR sekvenēšanai 6. segmentā var izmantot šādu metodi:

tiešais praimeris: 5’-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3’,

atgriezeniskais praimeris: 5’-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3’.

Produkta izmērs: 304 nt, ja HPR0.

Var izmantot arī RT-PCR testus ar tādu pašu jutīgumu un specifiskumu kā šajā punktā aprakstītajiem testiem.

Pirms sekvenēšanas amplificētā RT-PCR produkta tīrību pārbauda ar gela elektroforēzi. Ja iegūts tikai viens tīrs fragments, to attīra tieši pēc PCR reakcijas. Ja ir vairāki amplificēti fragmenti, ar gela elektroforēzi attīra interesējošo fragmentu. PCR fragmentus no šķīdumiem vai agarozes geliem attīra, PCR fragmentiem saskaņā ar ražotāja norādījumiem izmantojot afinitātes rotācijas stobriņus.

Sekvenēšanu ar amplifikācijas praimeru palīdzību izdara sekvenēšanā specializējušās ārpakalpojumu firmas. Sekvenēšanas rezultātus analizē ar meklēšanas rīku BLAST, un sekvences salīdzina ar citām zināmām sekvencēm ASV Nacionālā Biotehniskās informācijas centra (NCBI) nukleotīdu datubāzē.

Sekvenēšanai jānovērš jebkādas šaubas par amplificēta RT-PCR produkta specifiskumu.

2. Lašu infekciozās anēmijas vīrusa izolēšana uz šūnu kultūrām

2.1. Paraugu sagatavošana

Audus var glabāt - 80 °C temperatūrā. Pirms izmeklēšanas audus sasaldē un atkausē tikai vienu reizi. Uzraudzības un kontroles nolūkiem izmeklēšanu veic iespējami drīz.

Katru paraugu (kopotos audus pārvadāšanas šķīdumā) pilnīgi homogenizē, izmantojot validētu homogenizētāju, 0 līdz 6 °C temperatūrā 15 minūtes centrifugē (2000 līdz 4000 x apgriezieniem/minūtē), un centrifugātu pēc filtrācijas (0,45 μm) inkubē ar vienādu tilpumu pienācīgi atšķaidīta pret IPNV vietējiem serotipiem izstrādājušos antiserumu maisījuma. Antiseruma titram 50 % plātnīšu neitralizācijas testā jābūt vismaz 1:2000. Maisījumu vienu stundu inkubē 15 °C temperatūrā. Šādi iegūst inokulātu.

Visu inokulātu apstrādei ar infekciozās pankreātiskās nekrozes vīrusa antiserumu (vīruss atsevišķās Eiropas daļās sastopams 50 % zivju paraugos) ir mērķis novērst infekciozās pankreātiskās nekrozes vīrusa izraisītu CPE inokulētajās šūnu kultūrās. Šādu apstrādi var veikt, lai samazinātu virusoloģisko izmeklējumu ilgumu, kā arī to gadījumu skaitu, kuros būtu jāuzskata, ka CPE potenciāli liecina par lašu infekciozās anēmijas vīrusu. Ja paraugi ir no ražošanas vienībām, kuras uzskata par brīvām no infekciozās pankreātiskās nekrozes, inokulātus ar infekciozās pankreātiskās nekrozes vīrusa antiserumu var neapstrādāt.

2.2. Šūnu kultūru inokulēšana

Primārajai lašu infekciozās anēmijas vīrusa izolēšanai izmanto Atlantijas laša nieru (ASK) šūnas. Ņemot vērā celmu mainīgumu un to, ka dažādu celmu vairošanās spēja dažādās šūnu līnijās atšķiras, var izmantot arī citas šūnu līnijas, par kurām pierādīts, ka tās ir pietiekami produktīvas un jutīgas lašu infekciozās anēmijas vīrusa izolēšanai. Ja vien izmanto zemu pasāžas līmeni, uzskatāms, ka līdz šim zināmo vīrusu izolātu izolēšana un augšana ASK šūnās noris labvēlīgi. ASK šūnām var novērot izteiktāku CPE nekā citām uzņēmīgām šūnu līnijām, piemēram, SHK-1 (laša galvasnieres šūnas-1).

ASK (65. vai agrāks pārsējums) šūnas audzē daudziedobju platēs barotnē L-15, kas satur 10 % liellopu embrionālā seruma, 200 mM L-glutamīna tilpumkoncentrācijā 2 % un 50 mM 2-merkaptoetanola tilpumkoncentrācijā 0,08 %. Ar antiserumu apstrādātu orgānu suspensiju inokulē jaunu, aktīvi augošu šūnu kultūrās, raugoties, lai galīgajā atšķaidījumā audu materiāla attiecība pret kultūras barotni būtu 1:1000. Par katru orgānu iedobē ar 2 ml kultivēšanas barotnes ievada 40 μl inokulāta suspensijas. Lai līdz minimumam samazinātu krusteniskās kontaminācijas risku, paraugiem no dažādām zivaudzētavas vietām izmanto atsevišķas plates ar 12 vai 24 iedobēm.

Vienu plati atstāj bez inokulāta un izmanto par negatīvo kontrolparaugu. Par pozitīvu kontrolparaugu izmantojamu lašu infekciozās anēmijas vīrusa standartizolātu atsevišķā platē inokulē šādi. Pirmajā iedobē inokulē simt μl ISAV izejpreparāta (minimālais titrs 107, audu kultūras inficējošā deva ar beigu punktu 50 % (TCID50 ml-1)) un samaisa. Noteiktu šā materiāla tilpumu no pirmās iedobes pārvieto otrajā tā, lai iegūtais atšķaidījums būtu attiecībā 1:10, un samaisa. Šo procedūru atkārto tā, lai desmitkārtīgu atšķaidījumu iegūtu sešās iedobēs. Lašu infekciozās anēmijas vīrusa izejpreparātu - 80 °C temperatūrā var glabāt vismaz divus gadus, bet pēc atkausēšanas tas jāizlieto trīs dienu laikā. Jāraugās, lai testa platēs nepieļautu krustenisko kontamināciju ar pozitīvās kontroles materiālu. Lai izvairītos no šāda riska, pozitīvos kontrolparaugus sagatavo un ar tiem darbojas atsevišķi no testa platēm. Tā vietā, lai inokulēšanā katrreiz izmantotu pozitīvu kontrolparaugu, var ik sešus mēnešus testēt ASK šūnu jutīgumu pret lašu infekciozās anēmijas vīrusa izolātiem.

Paraugus ne ilgāk kā 15 dienas inkubē 15 ± 2 °C temperatūrā. Šūnu kultūras mikroskopā attiecībā uz CPE pārbauda divas reizes - laikā no piektās dienas līdz septītajai un no 12. līdz 14. dienai pēc inokulēšanas. Ja kādam kopotam paraugam vērojams CPE, nekavējoties saskaņā ar šī nodaļas 2.4. apakšpunktu sāk vīrusa identificēšanas procedūras. Ja līdz 14. dienai CPE netiek novērots, izdara netiešās imūnfluorescences antivielu testu (IFAT), hemadsorbcijas testu vai RT-PCR.

2.3. Šūnu pārsēšana

Šūnas pārsēj laikā starp 13. un 15. dienu. Attiecīgi atšķaidītu (1:10) kultūras centrifugātu ievada iedobēs, kurās ir svaigas, aktīvi augošas šūnas, un 14 ± 2 °C temperatūrā inkubē ne ilgāk kā 18 dienas. Šūnu kultūras mikroskopā attiecībā uz CPE pārbauda divas reizes - laikā no piektās dienas līdz septītajai un no 14. līdz 18. dienai pēc inokulēšanas. Ja kādam kopotam paraugam vērojams CPE, nekavējoties saskaņā ar šīs nodaļas 2.4. apakšpunktu sāk vīrusa identificēšanas procedūras. Ja līdz 14. līdz 18. dienai CPE netiek novērots, veic hemadsorbcijas testu vai RT-PCR testu.

Ja citotoksicitāti novēro pirmajās septiņās inkubācijas dienās, šūnas pārsēj tajā posmā un 14 līdz 18 dienas inkubē, pēc tam tās atkal pārsēj un inkubē vēl 14 līdz 18 dienas. Ja citotoksicitāti novēro pēc septiņām dienām, šūnas pārsēj vienu reizi un no pirmās inokulēšanas inkubē pavisam 28 līdz 36 dienas.

Ja primārajā kultūrā vērojama bakteriāla kontaminācija, testu sagatavo vēlreiz, izmantojot - 80 °C temperatūrā glabāto audu homogenātu. Audu homogenātu pirms inokulēšanas 0 līdz 6 °C temperatūrā 15 līdz 30 minūtes centrifugē 4000 × apgriziemiem/minūtē, un centrifugātu filtrē (0,22 μm). Ja bakteriālu kontamināciju

novēro šūnu pārsēšanas laikā, centrifugātu filtrē (0,22 μm), inokulē tikko pārsētām šūnām un inkubē vēl 14 līdz 18 dienas.

2.4. Vīrusa identificēšanas testi

Ja kaut vienā stadijā novēro CPE vai ja hemadsorbcijas tests ir pozitīvs, veic vīrusa identificēšanu. Lašu infekciozās anēmijas vīrusa identificēšanā vēlamā metode ir RT-PCR, ko veic saskaņā ar šīs nodaļas 1. punktu un imūnfluorescences (IF) metode saskaņā ar šīs nodaļas 2.6. apakšpunktu. Ja tiek uzskatīts, ka iespējama citu vīrusu klātbūtne, vīrusa identificēšanai veic papildu testus. Ja ar šiem testiem vīruss nedēļas laikā nav galīgi identificēts, centrifugātu nekavējošai identifikācijai nosūta tālāk uz:

a) Pasaules Dzīvnieku veselības organizācijas (OIE) references laboratoriju darbā ar ISA vai

b) uz Latvijas valsts references laboratoriju vai citu Eiropas Savienības dalībvalstu references laboratoriju.

2.5. Hemadsorbcija

Tā kā lašu infekciozās anēmijas vīrusa replicēšanās šūnu kultūrās ne vienmēr rada CPE, tad katrā iedobē saskaņā ar šo punktu veic RT-PCR testu vai hemadsorbcijas testu vai saskaņā ar šīs nodaļas 2.6. apakšpunktu - IF testu.

No visām iedobēm, arī pozitīvo un negatīvo kontrolparaugu iedobēm, barotni ar šūnu kultūru izņem un ievieto etiķetētās sterilās mēģenēs. Katrā iedobē iepilda piecsimt μl skalotu truša vai zirga eritrocītu tilpumkoncentrācijā 0,2 % vai skalotas varavīksnes foreles vai Atlantijas laša eritrocītu suspensijas tilpumkoncentrācijā 0,05 % un istabas temperatūrā inkubē 45 minūtes. Pēc tam eritrocītu suspensiju izlej un katru iedobi divreiz izskalo ar barotni L-15. Katru iedobi pārbauda mikroskopā.

Ja uz ASK šūnu virsmas ir eritrocītu sakopojumi, ir iespējama inficēšanās ar ortomiksovīrusu. Ja hemadsorbcijas tests ir pozitīvs, nekavējoties saskaņā ar šīs nodaļas 2.4. apakšpunktu veic vīrusa identificēšanas testu.

2.6. Imūnfluorescence (IF)

ASK (65. vai agrāks pārsējums) daudziedobju platēs audzē barotnē L-15, kas satur 10 % liellopu embrionālā seruma, 200 mM L-glutamīna tilpumkoncentrācijā 2 % un 50 mM 2-merkaptoetanola tilpumkoncentrācijā 0,08 %, un izmanto tad, kad konfluence pārsniegusi 50 %. Var izmantot arī citas šūnu līnijas vai barotni, kuru lietderīgums ir pierādīts. Divās iedobēs katrā iepilda 225 μl ar vīrusu varbūtēji inficētas kultūras centrifugāta, samaisa un 225 μl iepilda vēl divās iedobēs, iegūstot atšķaidījumu 1:5. Vēl divās iedobēs inokulātu neievada, un tās izmanto par kontrolparaugiem. Paraugiem no katras zivju audzētavas, kā arī vīrusa kontrolei izmanto atsevišķu plati. Vīrusa kontrolparaugam izmanto lašu infekciozās anēmijas vīrusa standartizolātu.

Plates inkubē 14 ± 2 °C temperatūrā un tās mikroskopiski pārbauda ne vēlāk kā 7 dienu laikā. Ja jau agrīnā stadijā novēro CPE, kā arī tad, ja 7 dienu laikā CPE nenovēro, nākamais solis ir fiksācija. Iedobes skalo ar fosfātu buferšķīdumu (PBS) un istabas temperatūrā 20 minūtes ar inkubācijas paņēmienu fiksē ar 80 % acetonu.

Plates žāvē ar gaisa plūsmu un uzreiz nokrāso vai pirms krāsošanas ne ilgāk kā 24 stundas glabā 0 līdz 6 °C temperatūrā.

Replicētas iedobes krāso ar maisījumu no lašu infekciozās anēmijas vīrusa monoklonālajām antivielām (MAb) 3H6F8 un 1OC9F5 vai ar citu MAb, kuras iedarbīgums un specifiskums ir pierādīti, pēc tam fosfātu buferšķīdumā atšķaida un 30 minūtes inkubē 37 ± 4 °C temperatūrā. Tad plates atbrīvo no monoklonālās antivielas un trīs reizes skalo ar 0,05 % Tween 20 fosfātu buferšķīdumā. Katrā iedobē iepilda ar fosfātu buferšķīdumu atšķaidītu peļu antivielas IgG un fluorescīna izotiocianāta konjugātu (FITC) un 30 minūtes inkubē 37±4 °C temperatūrā. Monoklonālo antivielu un FITC konjugāta dažādo partiju atšķaidījumus katrā laboratorijā optimizē. Plates atbrīvo no antivielas un trīs reizes skalo 0,05 % Tween 20 fosfātu buferšķīdumā.

Tūlīt pēc tam iedobes pārbauda inversijas mikroskopā, kas pielāgots fluorescences mikroskopijai un aprīkots ar FITC ierosai piemērotu filtru. Ja novēro fluorescējošas šūnas, uzskata, ka tests ir pozitīvs. Pārbaude ir derīga tikai tad, ja pozitīvajiem kontrolparaugiem rezultāti ir pozitīvi, bet negatīvajiem — negatīvi.

3. Citu audu izmeklēšana

Šīs nodaļas 2.6. apakšpunktā minēto paņēmienu var izmantot arī citiem audiem, piemēram, aknām, liesai un sirdij, ja vien uz priekšmetstikliņu izdodas pārnest pietiekami daudz endotēlija šūnu, leikocītu vai limfocītu. Visiem audiem izmanto vienu un to pašu krāsošanas paņēmienu, lai gan dažus audus nebūtu vēlams krāsot ar propīdija jodīdu, bet gan šūnu tipu audu nospiedumā noteikt ar fāzu kontrastmikroskopu.

4. Histoloģija

No parafīnā ieguldītiem griezumiem ņem 5 μm biezus griezumus un krāso ar hematoksilīnu un eozīnu.

Klīniski slimu Atlantijas lašu organismā ir vērojamas mainīgas histoloģiskās pārmaiņas, taču to vidū var būt šādas:

(a) vairāki eritrocīti centrālajā venozajā sinusā un plātnīšu kapilāros žaunās, kur var veidoties arī eritrocītu trombi;

(b) blakus aknu lielajiem asinsvadiem vērojamas vairākperēkļu vai saplūdušas petehijas, hepatocītu nekroze vai abi procesi; perēkļveida eritrocītu sakopojumi paplašinātos aknu sinusoīdos;

(c) eritrocītu uzkrāšanās zarnu lamina propria asinsvados un varbūtēji asiņošana lamina propria;

(d) eritrocītu uzkrāšanās rezultātā palielinājusies liesas stroma;

(e) intersticiāla asiņošana – no vieglas vairākperēkļu līdz plašai difūzai – ar kanāliņu nekrozi asiņošanas vietās, eritrocītu uzkrāšanās nieru kamoliņos;

(f) eritrofagocitoze liesā un sekundāra asiņošana aknās un nierēs.

5. Imūnhistoķīmija (IHC)

Formalīnā fiksētu audu parafinētiem griezumiem izmanto poliklonālas antivielas pret ISAV nukleoproteīnu. Izmeklē vidusnieri un sirdi (pārejas vieta, kurā ietilpst trīs kambari un vārsti). Patoloģisku pazīmju radītu aizdomu gadījumus pārbauda, izmantojot pozitīvu IHC. Histoloģiskos griezumus sagatavo pēc standartmetodēm.

5.1. Audu griezumu sagatavošana

Audus saskaņā ar standartprotokoliem vismaz vienu dienu fiksē neitrālā 10 % formalīna fosfātu buferšķīdumā, atūdeņo ar pakāpeniski pieaugoša stipruma etilspirtu, dzidrina ar ksilēnu un iegulda parafīnā. Patomorfoloģijas un IHC vajadzībām apmēram 5 μm biezus griezumus (IHC vajadzībām - uz stikliņiem ar poli-L-lizīna apvalku) 20 minūtes karsē 56 °C līdz 58 °C (maksimāli 60 °C) temperatūrā, ar ksilēna palīdzību atvasko, ar pakāpeniski sarūkoša stipruma etilspirtu rehidratē, kā arī saskaņā ar 2. punktu krāso ar hematoksilīnu un eozīnu.

5.2. Krāsošanas procedūra IHC vajadzībām

Jebkādu inkubēšanu veic istabas temperatūrā uz svārstplatformas, ja vien šajā lēmumā nav paredzēts citādi:

(a) antigēnu atgūšanu nodrošina, griezumus 2 × 6 minūtes vārot 0,1 M citrāta buferšķīdumā ar pH 6,0, pēc kā 20 min veic bloķēšanu ar 5 % piena beztauku sausnas un 2 % kazas seruma 50 mM TBS šķīdumā (TBS; Tris/HCl 50 mM, NaCl 150 mM, pH 7,6);

(b) pēc tam griezumus uz nakti inkubē ar primāru antivielu (monospecifisku truša antivielu pret lašu infekciozās anēmijas vīrusa nukleoproteīnu), kura atšķaidīta 1 % piena beztauku sausnas saturošā TBS, pēc tam trīsreiz skalo ar 0,1 % Tween 20 saturošu TBS;

(c) saistītu antivielu konstatēšanai griezumus 60 minūtes inkubē truša IgG antivielas sārmainās fosfatāzes konjugātā. Pēc galīgās skalošanas pievieno Fast Red (1 mg ml-l) un naftola AS-MX fosfātu (0,2 mg ml-1) ar 1 mM levamizola 0,1 M TBS (pH 8,2) un dod iespēju 20 minūtes attīstīties. Pēc tam griezumus skalo krāna ūdenī, kontrastam krāso ar Harisa hematoksilīnu un pārklāj ar pārklājbarotni uz ūdens bāzes. Katrā testa sagatavošanā iekļauj kontrolparaugus - attiecībā uz lašu infekciozās anēmijas vīrusu gan pozitīvus, gan negatīvus audu griezumus.

5.3. IHC rezultātu interpretēšana

IHC testa rezultātus interpretē tā, kā aprakstīts turpmāk šī punkta a) un b) apakšpunktā:

a) kontrolgriezumus par pozitīviem uzskata tad, ja kontrolgriezumiem skaidri saskatāms, ka endokarda asinsvadu endotēlija šūnu citoplazma un kodols ir iekrāsoti sarkani (sarkanīgi). Testa parauga griezumu uzskata par pozitīvu tikai tad, ja šādu skaidri saskatāmu sarkanu kodola iekrāsojumu konstatē endotēlija šūnām;

b) kontrolgriezumus par negatīviem uzskata tad, ja tiem nav novērojama nekāda būtiska krāsas reakcija.

Tā kā ortomiksovīrusa nukleoproteīnam vīrusa replikācijas stadijā ir raksturīga lokalizācija kodolā, taču bieži vien vienlaicīgi izteiktāk tiek iekrāsota citoplazma. Tāds citoplazmas iekrāsojums un cita veida iekrāsojums, kas nav lokalizēts kodolā, uzskatāms par nespecifisku vai neizšķirīgu.

Pozitīvā gadījumā izteiktākās iekrāsojuma reakcijas parasti vērojamas sirds un nieru endotēlija šūnās. Ļoti plašos hemorāģiskos bojājumos endotēlija krāsojuma reakcijas var būt maz izteiktas vai vispār nav novērojamas, iespējams, inficētajās endotēlija šūnās notiekošas līzes dēļ.

IIX. Laboratoriskās diagnostikas metodes Marteilia refringens infekcijas apstiprināšanai

1. Paraugu ņemšanas procedūra

Lai varbūtība atrast inficētus dzīvniekus būtu lielāka, paraugus ņemot, priekšroka ir gliemenēm, kas pavērušās vai tikko nobeigušās.

Paraugam ņemtās austeres vai ēdamgliemenes plastmasas maisiņā, kura etiķete satur informāciju par austeru vai ēdamgliemeņu izcelsmi un īpašībām, 4 °C temperatūrā vai uz atdzesēta ledus tur ne ilgāk kā 24 stundas, ja paraugā ir pavērušās gliemenes, un ne ilgāk kā 72 stundas, ja tajā pavērušos gliemeņu nav. Pavērušās vai tikko nobeigušās gliemenes tur atsevišķi no citām gliemenēm.

Marteilia refringens histoloģiskai diagnosticēšanai izmanto 3 līdz 5 mm biezu audu griezumu, kurā ietilpst žaunas un sirds audi. Dažiem testiem, arī nospiedumiem un polimerāzes ķēdes reakcijai (PCR) izmanto gremošanas dziedzera audus.

2. Mikroskopiskie paņēmieni

2.1. Citoloģija (nospieduma citoloģija)

Kad gremošanas dziedzera audi apžāvēti uz absorbējoša papīra, uz priekšmetstikliņa atstāj vairākus nospiedumus. Priekšmetstikliņu preparātus ar gaisa plūsmu nožāvē, fiksē metilspirtā vai absolūtajā spirtā un nokrāso, saskaņā ar ražotāja norādījumiem izmantojot kādu no tirdzniecībā pieejamiem asins preparātu krāsošanas reaģentu komplektiem, tādu kā Diff-Quik®/Hemacolor®. Kad stikliņi krāna ūdenī noskaloti un nosusināti, tiem ar piemērotas sintētiskas gumijas palīdzību uzliek segstiklu. Priekšmetstikliņus vispirms novēro palielinājumā x200 un pēc tam – iegremdētus eļļā palielinājumā x1000.

Rezultāts ir pozitīvs tad, ja novēro šūnas, kuru izmērs ir no 30 līdz 40 μm. Citoplazmu iekrāso bazofilie, savukārt kodolu – eozinofilie leikocīti. Var novērot blāvus lokus ap lielām, stipri iekrāsotām (atstarojošām) granulām un, lielākās šūnās, šūnu šūnā.

Šis paņēmiens izmantojams jebkādām parazītu sugām.

2.2. Histoloģija

Audu griezumus, kuros ietilpst žaunas, gremošanas dziedzeris, mantija un gonādas, vismaz 24 stundas fiksē Davidson fiksatīvā, pēc tam parastajā veidā apstrādā ar parafīnu histoloģiskai izmeklēšanai un krāso, piemēram, ar hematoksilīnu un eozīnu. Novērojumus veic arvien augstākā palielinājumā līdz ×1000.

Rezultāts ir pozitīvs tad, ja novēro šūnas, kuru izmērs ir no 4 līdz 40 μm. Agrīnās stadijās ir vērojamas vairākkodolu šūnas un šūnas, kuru forma ir no sfēriskas līdz pagarinātai. Tās konstatē galvenokārt barības vada un kuņģa, dažkārt lūpu taustekļu epitēlijā. Sporulācija saistās ar šūnu dalīšanos šūnu iekšpusē un notiek gremošanas dziedzera kanāliņos un vados. Sporulācijas procesā rodas atstarojošas granulas, taču agrīnos posmos tās nenovēro. Infekcijas vēlīnās stadijās atsevišķus sporangijus novēro gremošanas trakta lūmenā. Citoplazmu iekrāso bazofilie, savukārt kodolu – eozinofilie leikocīti. Granulu krāsa var variēt no tumši oranžas līdz tumšsarkanai.

Šis paņēmiens izmantojams jebkādām parazītu sugām.

3. Molekulārie paņēmieni

3.1. DNS ekstrahēšana

DNS ekstrahē saskaņā ar standartprocedūrām.

Drīkst izmantot tirdzniecībā pieejamos DNS ekstrahēšanas komplektus, ar kuriem iegūstama augsti kvalitatīva DNS, kas piemērota izmantošanai I.3.2. punktā aprakstītajos PCR protokolos.

3.2. Polimerāzes ķēdes reakcija (PCR)

Ir izstrādāti un publicēti vairāki PCR protokoli.

Jāizmanto tie PCR praimeri, kuru mērķrajons ir iekšējā transkribētā speisera (ITS1) rajons, jo tie spēj amplificēt tikai M. refringens.

PCR īsteno 50 μl tilpumā. PCR maisījumi satur buferšķīdumu (500 mM KCl, 100 mM Tris/HCl [pH 9,0 25 °C temperatūrā] un 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP maisījuma, 1 μM tiešā un atgriezeniskā praimera, 0,02 vienības μl–1 Taq DNS polimerāzes, un 10 līdz 100 ng ekstrahētas DNS. Kad DNS piecas minūtes denaturēta 94 °C, veic šādus 30 ciklus: denaturācija ar 94 °C 1 min, hibridizācija ar 55 °C 1 min, un – vienu minūti uz katru kilobāzes pāri – elongācija ar 72 °C. Veic pēdējo elongācijas soli – 10 minūtes 72 °C temperatūrā. M. refringens konstatēšanai izdara PCR ar praimeriem, kuru mērķrajons ir ITS1 (5’-CCG-CAC-ACG-TTC-TTC-ACT-CC-3’ un 5’-CTC-GCG-AGT-TTC-GAC-AGA-CG-3’).

Pozitīvie kontrolparaugi ir no stipri inficēta saimniekorganisma iegūta genomiskā DNS vai plazmīdu DNS, kurām ir mērķrajons.

Negatīvo kontrolparaugu sastāvā ir iekļauti no neinficētiem saimniekorganismiem iegūts genomiskais DNS un PCR reaģenti bez mērķa DNS.

Pozitīvs rezultāts ir pozitīva PCR amplifikācija sagaidāmajā izmērā (412 bp), visu negatīvo kontrolparaugu rezultātiem esot negatīviem un visu pozitīvo kontrolparaugu rezultātiem – pozitīviem.

3.3. In situ hibridizācija (ISH)

Izstrādāti un publicēti ir vairāki ISH protokoli.

Izmanto provi, kuras mērķrajons ir rRNS gēnu kompleksa mazā apakšvienība, jo tā ir histoloģiski validēta.

Audu griezumus, kuros ietilpst žaunas un gremošanas dziedzeris, vismaz 24 stundas fiksē Davidson fiksatīvā un pēc tam parastajā veidā apstrādā ar parafīnu histoloģiskai izmeklēšanai. Nogriež 5 μm biezus griezumus, ko novieto uz priekšmetstikliņiem ar aminoalkilsilāna pārklājumu un pēc tam uz nakti karsē 40 °C karstā krāsnī.

Griezumus atvasko, uz 10 minūtēm iegremdējot ksilēnā. Šo soli vienreiz atkārto un pēc tam atbrīvojas no šķīdinātāja, griezumus divreiz pēc kārtas uz 10 minūtēm iegremdējot absolūtā spirta peldēs. Pēc tam griezumus dehidratē, tos mērcējot augoša stipruma etilspirtā. Griezumus 37 °C temperatūrā 30 minūtes apstrādā ar proteināzi K (100 μg ml–1) TE buferšķīdumā (Tris [50 mM], EDTA [10 mM]). Stikliņus atūdeņo, tos mērcējot augoša stipruma etilspirtā, pēc tam ar gaisu nožāvē. Griezumus inkubē ar 100 μl hibridizācijas buferšķīduma (4× SSC [citrāta fizioloģiskā standartšķīduma], 50 % formamīda, 1× Denhardta šķīduma, 250 μg ml–1 rauga tRNS, 10 % dekstrāna sulfāta), kas satur 10 ng (1 μl PCR reaģentu, kuri sagatavoti, kā aprakstīts šīs nodaļas 3.2. apakšpunktā, izmantojot praimerus CCG-GTG-CCA-GGT-ATA-TCT-CG un TTC-GGG-TGG-TCT-TGA-AAG-GC) proves, kas marķēta ar digoksigenīnu. Griezumus pārsedz ar in situ plastmasas segstikliņiem un uz piecām minūtēm novieto uz karstumbloka 95 °C temperatūrā. Pirms stikliņus 42 °C temperatūrā uz nakti atstāj hibridizēties mitrā kamerā, tos uz ledus vienu minūti atdzesina. Griezumus divreiz pa piecām minūtēm istabas temperatūrā skalo 2× SSC un vienreiz 10 minūtes 42 °C temperatūrā skalo 0,4× SSC. Konstatēšanas soļus veic saskaņā ar ražotāja norādījumiem. Pēc tam stikliņus skalo sterilā destilētā ūdenī (dH2O). Griezumu krāsu neitralizē ar Bismarck Brown Yellow, skalo ar dH2O un, izmantojot pārklājbarotni uz ūdens bāzes, uzliek segstikliņus.

Pozitīvie un negatīvie kontrolparaugi attiecīgi ir griezumi no zināmiem inficētiem un neinficētiem saimniekorganismiem.

Visiem negatīvajiem kontrolparaugiem esot negatīviem un visiem pozitīvajiem kontrolparaugiem — pozitīviem, par pozitīvu rezultātu liecina violeti melni iekrāsotas M. refringens šūnas zināmos mērķaudos.

3.4. Sekvenēšana

Sekvenēšanu veic kā vienu no apstiprinošas diagnosticēšanas galīgajiem soļiem. Mērķrajoni ir rDNS mazā apakšvienība un ITS1.

IX. Laboratoriskās diagnostikas metodes Marteilia refringens uzraudzībai

Lai īstenotu uzraudzības programmas un apstiprinātu Marteiliozes (Marteilia refringens) klātbūtni vai izslēgtu aizdomas par šo slimību, izmanto diagnostikas metodes un attiecīgas procedūras, kā ir norādīts turpmāk tabulas vadlīnijās.

Vadlīnijas par diagnostikas metožu izmantošanu uzraudzības programmās un Marteiliozes (Marteilia refringens) apstiprināšanai vai izslēgšanai

N.p.k. Metode Mērķorientēta uzraudzība Prezumptīvā diagnoze Apstiprinošā diagnoze
1. Gremošanas dziedzera nospiedumi X X X vai
2. Histopatoloģija X   X vai
3. In situ hibridizācija   X un  
4. PCR X X X un
5. Sekvenēšana   X  

X. Laboratoriskās diagnostikas metodes Bonamia ostreae infekcijas diagnosticēšanai.

1. Paraugu ņemšanas process

Lai varbūtība atrast inficētus dzīvniekus būtu lielāka, paraugus ņemot, priekšroka ir gliemenēm, kas pavērušās vai tikko nobeigušās.

Paraugam ņemtās austeres plastmasas maisiņā, kura etiķete satur informāciju par austeru izcelsmi un īpašībām, 4 °C temperatūrā vai uz atdzesēta ledus tur ne ilgāk kā 24 stundas, ja paraugā ir pavērušās gliemenes, un ne ilgāk kā 72 stundas, ja tajā pavērušos gliemeņu nav. Pavērušās vai tikko nobeigušās gliemenes tur atsevišķi no citām gliemenēm.

Bonamiozes histoloģiskai diagnosticēšanai izmanto 3 līdz 5 mm biezu audu griezumu, to vidū no žaunām un sirds audiem. Dažiem testiem, arī nospiedumiem un polimerāzes ķēdes reakcijai (PCR), izmanto gremošanas dziedzera audus.

2. Mikroskopiskie paņēmieni

2.1. Citoloģija (nospieduma citoloģija)

Kad žaunas vai sirds audi apžāvēti uz absorbējoša papīra, uz priekšmetstikliņa atstāj vairākus nospiedumus. Priekšmetstikliņu preparātus ar gaisa plūsmu nožāvē, fiksē metilspirtā vai absolūtajā spirtā un nokrāso, saskaņā ar ražotāja norādījumiem izmantojot kādu no tirdzniecībā pieejamajiem asins preparātu krāsošanas reaģentu komplektiem, konkrētāk, tādu kā Diff-Quik®/Hemacolor®. Kad stikliņi krāna ūdenī noskaloti un nosusināti, tiem ar piemērotas sintētiskas gumijas palīdzību uzliek segstiklu. Priekšmetstikliņus vispirms novēro palielinājumā x200 un pēc tam – iegremdētus eļļā palielinājumā x1000.

Pozitīvs rezultāts būs mazu (2 līdz 5 μm platu) lodveida vai olveida organismu klātbūtne hemocītos. Tomēr parazīta klātbūtne iespējama arī ārpus šūnām. Šiem organismiem citoplazmā vērojami bazofilie leikocīti un kodolā – eozinofilie leikocīti (krāsa var atšķirties atkarībā no krāsošanas līdzekļa) un, tā kā uz priekšmetstikliņa tie izplūst, uz nospiedumiem tie var izskatīties platāki nekā histoloģiskā izmeklēšanā. Var būt novērojamas daudzkodolu šūnas. Šis paņēmiens izmantojams jebkādām parazītu sugām.

2.2. Histoloģija

Audu griezumus, kuros ietilpst žaunas un gremošanas dziedzeris, vismaz 24 stundas fiksē Davidson fiksatīvā, pēc tam parastajā veidā apstrādā ar parafīnu histoloģiskai izmeklēšanai un krāso, piemēram, ar hematoksilīnu un eozīnu. Novērojumus veic arvien augstākā palielinājumā līdz ×1000.

Pozitīvs rezultāts ir parazītu klātbūtne, kas izpaužas kā ļoti mazas, 2 līdz 5 μm platas šūnas, kuras novērojamas hemocītos vai atsevišķi žaunu, zarnu un mantijas epitēlija saistaudos vai dobumos un bieži vien saistās ar spēcīgu iekaisuma reakciju. Lai izslēgtu jebkādas šaubas un uzstādītu pozitīvu diagnozi, vajadzīgs, lai parazīts būtu novērots hemocītā. Šis paņēmiens izmantojams jebkādām parazītu sugām.

3. Molekulārie paņēmieni

3.1. DNS ekstrahēšana

DNS ekstrahē saskaņā ar standartprocedūrām.

Drīkst izmantot tirdzniecībā pieejamos DNS ekstrahēšanas komplektus, ar kuriem iegūstama augsti kvalitatīva DNS, kas piemērota izmantošanai turpmāk aprakstītajos PCR protokolos.

3.2. Polimerāzes ķēdes reakcija (PCR)

Izstrādāti un publicēti ir vairāki PCR protokoli.

Var izmantot divus PCR protokolus, kuros mērķrajons ir rDNS mazā apakšvienība:

(a) pirmais ir parastā PCR, ar kuru amplificē vairākus Haplosporidia pārstāvjus, arī Bonamia spp. Praimeri, ko apzīmē kā Bo un Boas, ir attiecīgi 5’-CAT-TTA-ATT-GGT-CGG-GCC-GC-3’ un 5’-CTG-ATC-GTC-TTC-GAT-CCC-CC-3’, un to amplifikācijas produkts ir 300 bp. PCR maisījumi satur buferšķīdumu (500 mM KCl, 100 mM Tris/HCl [pH 9 25 °C temperatūrā] un 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP maisījuma, 1 μM tiešā un atgriezeniskā praimera, 0,02 vienības μl–1 Taq DNS polimerāzes, un 0,2 ng μl–1 DNS veidnes kopējā apjomā 50 μl. Vispirms paraugus DNS amplifikatorā ar 94 °C 5 min denaturē, pēc tam ar tiem veic 30 ciklus (94 °C viena min, 55 °C viena min, 72 °C viena min), pēc tam 10 minūtes 72 °C temperatūrā veicot galīgo paplašināšanu.

Pozitīvie kontrolparaugi ir no stipri inficēta saimniekorganisma iegūta genomiskā DNS vai plazmīdu DNS, kurām ir mērķrajons.

Negatīvo kontrolparaugu sastāvā ietilpst no neinficētiem saimniekorganismiem iegūts genomiskais DNS un PCR reaģenti bez mērķa DNS.

Pozitīvs rezultāts ir pozitīva PCR amplifikācija sagaidāmajā izmērā (proti, 300 bp), visiem negatīvajiem kontrolparaugiem esot negatīviem un visiem pozitīvajiem kontrolparaugiem – pozitīviem;

(b) otrais PCR protokols ir SYBR® Green reāllaika PCR. Ar tā palīdzību ir iespējams specifiski noteikt B. ostreae (aprakstīts zemāk) un to var kombinēt ar SYBR® Green reāllaika PCR, kas dod iespēju specifiski noteikt B. exitiosa (Ramilo et al. 2013).

Praimeri BOSTRE-F (5’- TTACGTCCCTGCCCTTTGTA-3’) un BOSTRE-R (5’- TCGCGGTTGAATTTTATCGT-3’) amplificē 208 bp produktu. PCR maisījumi satur SYBR® Green Master Mix (1X), 0,3 μM tiešā un atgriezeniskā praimera un 200 ng ekstrahētas DNS. Paraugus vispirms ar 95 °C 10 minūtes denaturē reāllaika detektēšanas sistēmā, pēc tam ar tiem izpilda 35 ciklus (ar 95 °C 30 sekundes, ar 55 °C 45 ssekundes un ar 72 °C viena min). Ar temperatūras paaugstināšanās soli 0,5 ºC/s analizē kušanas temperatūras līkni, to sākot 55 ºC temperatūrā un beidzot 95 ºC temperatūrā un pie katras temperatūras maiņas fiksējot fluorescenci.

Pozitīvie kontrolparaugi ir no stipri inficēta saimniekorganisma iegūta genomiskā DNS vai plazmīdu DNS, kurām ir mērķrajons.

Negatīvo kontrolparaugu sastāvā ietilpst no neinficētiem saimniekorganismiem iegūts genomiskais DNS un PCR reaģenti bez mērķa DNS.

Visiem negatīvajiem kontrolparaugiem esot negatīviem un visiem pozitīvajiem kontrolparaugiem esot pozitīviem, pozitīvs rezultāts ir pozitīva PCR amplifikācija ar unikālu kušanas temperatūras maksimumu (ar nosacījumiem, kādus 2013. gadā publicējis Ramilo et al. – 78,25 ± 0,25 °C).

3.3. In situ hibridizācija (ISH)

Ir izstrādāti un publicēti vairāki ISH protokoli.

Izmanto provi, kuras mērķrajons ir rRNS gēnu kompleksa mazā apakšvienība. Ir pierādījumi, ka tā krusteniski reaģē ar dažiem citiem pie Haplosporidia dzimtas piederīgiem organismiem.

Audu griezumus, kuros ietilpst žaunas un gremošanas dziedzeris, vismaz 24 stundas fiksē Davidson fiksatīvā un pēc tam parastajā veidā apstrādā ar parafīnu histoloģiskai izmeklēšanai. Nogriež 5 μm biezus griezumus, ko novieto uz priekšmetstikliņiem ar aminoalkilsilāna pārklājumu un pēc tam uz nakti karsē 40 °C karstā krāsnī. Griezumus atvasko, uz 10 minūtēm iegremdējot ksilēnā. Šo soli vienreiz atkārto un pēc tam atbrīvojas no šķīdinātāja, griezumus divreiz pēc kārtas uz 10 minūtēm iegremdējot absolūtā spirta peldēs. Pēc tam griezumus rehidratē, tos mērcējot dilstoša stipruma etilspirtā. Griezumus pie 37 °C 30 minūtes apstrādā ar proteināzi K (100 μg ml–1) TE buferšķīdumā (Tris [50 mM], EDTA [10 mM]). Stikliņus atūdeņo, tos mērcējot augoša stipruma etilspirtā, pēc tam ar gaisu nožāvē. Griezumus inkubē ar 100 μl hibridizācijas buferšķīduma (4× SSC [citrāta fizioloģiskā standartšķīduma], 50 % formamīda, 1× Denhardta šķīduma, 250 μg ml–1 rauga tRNS, 10 % dekstrāna sulfāta), kas satur 20 ng (2 μl PCR reakcijas, kas sagatavota, kā aprakstīts šīs nodaļas 3.2. apakšpunktā, izmantojot praimerus Bo un Boas) proves, kas marķēta ar digoksigenīnu. Griezumus pārsedz ar in situ tipa plastmasas segstikliņiem, un uz piecām minūtēm novieto uz karstumbloka 95 °C temperatūrā. Pirms stikliņus 42 °C temperatūrā uz nakti atstāj hibridizēties mitrā kamerā, tos uz ledus vienu minūti atdzesina. Griezumus divreiz pa piecām minūtēm istabas temperatūrā skalo 2× SSC un vienreiz 10 minūtes 42 °C temperatūrā skalo 0,4× SSC. Konstatēšanas soļus izpilda saskaņā ar ražotāja norādījumiem. Pēc tam stikliņus skalo sterilā destilētā ūdenī (dH2O). Griezumu krāsu neitralizē ar Bismarck Brown Yellow, skalo ar dH2O un, izmantojot pārklājbarotni uz ūdens bāzes, uzliek segstikliņus.

Pozitīvie un negatīvie kontrolparaugi attiecīgi ir griezumi no zināmiem inficētiem un neinficētiem saimniekorganismiem.

Visiem negatīvajiem kontrolparaugiem esot negatīviem un pozitīvajiem esot pozitīviem, pozitīvs rezultāts ir hemocītos novērojami iekrāsoti parazīti.

3.4. Sekvenēšana

Sekvenēšanu veic kā vienu no apstiprinošas diagnosticēšanas galīgajiem soļiem. Mērķrajoni ir rDNS mazā apakšvienība un ITS1.

XI. Laboratoriskās diagnostikas metodes Bonamia ostreae infekcijas uzraudzībai un slimības diagnozes apstiprināšanai

Lai īstenotu uzraudzības programmas un apstiprinātu Bonamia ostreae klātbūtni vai izslēgtu aizdomas par inficēšanos ar to, izmanto diagnostikas metodes un attiecīgas procedūras, kas noteiktas turpmāk tabulas vadlīnijās.

Vadlīnijas par diagnostikas metožu izmantošanu uzraudzības programmās un Bonamia ostreae infekcijas apstiprināšanai vai aizdomu izslēgšanai par inficēšanos ar Bonamia ostreae

N.p.k. Metode Mērķorientēta uzraudzība Prezumptīvā diagnoze Apstiprinošā diagnoze
1. Sirds vai žaunu audu nospiedumi X X X vai
2. Histopatoloģija X   X vai
3. In situ hibridizācija   X un  
4. PCR X X X un
5. Sekvenēšana   X  

XII. Laboratoriskās diagnostikas metodes vēžu baltplankumu slimības apstiprināšanai

1.Šajā nodaļā aprakstītās metodes un procedūras ir pielāgotas no akreditētā ISO 17025 testa, ko izmanto vēžveidīgo slimībās specializētā Eiropas Savienības references laboratorija. Var izmantot alternatīvas pieejas, kurās izmanto līdzvērtīgus nosacījumus, vai komplektus, kurus ražojuši citi ražotāji, bet kuri piedāvā šajā daļā aprakstītajiem testiem līdzvērtīgu jutīgumu un specifiskumu. Visos gadījumos polimerāzes ķēdes reakcijā amplificēto produktu sekvenē, lai apliecinātu, ka tas identisks vēžu baltplankumu sindroma vīrusam.

2. Paraugu ņemšanas procedūra

No vēžveidīgajiem iegūtus vīrusu saturošus audus (vēderkājas un žaunas) var glabāt etilspirtā, RNAlater vai strauji −80 oC temperatūrā sasaldēt. Stadijas, kas nepieciešamas vēžu baltplankumu slimības vīrusa identificēšanai no audu paraugiem, ir šādas: audu homogenizēšana, DNS ekstrahēšana, vēžu baltplankumu slimības vīrusa DNS īpatnējā amplificēšana ar PCR, amplificētā produkta vizualizācija uz gela, DNS attīrīšana un sekvenēšana.

3. Audu homogenizēšana

Audu saārdīšanai un homogenāta sagatavošanai piemērotā buferšķīdumā izmanto audu saārdītāju FastPrep un Lysing Matrix A mēģenes (MP Biomedicals). Audus nosver, ievieto Lysing Matrix A mēģenēs, piemērotā buferšķīdumā (lietošanai ar DNS audu komplektu (Qiagen) – G2 un 10 μl K proteināzes) atšķaida, līdz masa/tilp. ir 1/10 vai kā norādījis ražotājs, un divas minūtes homogenizē ar homogenizētāju FastPrep 24. Homogenizētus paraugus inkubē 56 oC vismaz četras stundas vai pa nakti. Paraugus apstrādā virpuļmikserī, divas minūtes centrifugē ar 9000 rpm un 50 μl centrifugāta vai apjoma, kas līdzvērtīgs 5 mg audu (ekstrahēšanas komplektam optimāls audu svars), pievieno DNS ekstrahēšanai paredzētā parauga mēģenē un ar G2 buferšķīdumu apjomu palielina līdz 200 μl.

4. DNS ekstrahēšana

Kopējo DNS ekstrahē saskaņā ar ražotāja norādījumiem, izmantojot DNS audu ekstrahēšanas komplektu un EZ1 Advanced XL Biorobot (Qiagen). Katrai paraugu partijai apstrādā ekstrahēšanas kontrolparaugu (Calf Thymus DNS) un negatīvo kontrolparaugu (G2 buferšķīdums). DNS eluē 50 μl tilpumā. Lai nodrošinātu, ka ekstrahēšana beigusies sekmīgi, ar NanoDrop aparāta palīdzību nosaka DNS koncentrāciju visos paraugos un kontrolparaugos. Ja ekstrahētā DNS nav tūlīt nepieciešama, to sasaldē −20 oC temperatūrā.

Polimerāzes ķēdes reakcija (PCR), ar ko konstatē vēžu baltplankumu slimības vīrusu

WSSV konstatēšanai izmantojamā metode ir divsoļu atgriezeniskās transkriptāzes PCR un kurā pirmajā un otrajā PCR raundā amplificē rRNS gēna 18s 1447 bp un 848 bp amplikonu.

Pirmā raunda PCR reakcijai jāsagatavo 50 μl tilpums, kurā galīgajās koncentrācijās ir 1 x GoTaq Buffer (Promega), 5mM MgCl2, 1 pmol/μl WSSV praimera 146 F1, 1 pmol/μl WSSV praimera 146 R1, 0,25 mM dNTPs, 1,25 U Taq polimerāzes un 2,5 μl DNS. Reakciju ar visiem paraugiem izpilda dublikātā kopā ar negatīvu ekstrahēšanas kontrolparaugu, negatīvu PCR kontrolparaugu (DNS vietā pievienoti 2,5 μl H2O) un pozitīvu kontrolparaugu. Pozitīvais kontrolparaugs ir atšķaidīts vēžu baltplankumu slimības vīrusa plazmīds, kas saražots un validēts lietošanai attiecīgajā laboratorijā (pieejams no EURL).

N.p.k. Otrā raunda WSSV PCR reakciju sagatavo tāpat kā pirmā raunda reakciju, taču izmanto WSSV 146 F2/R2 praimeru komplektu un vēl vienu pozitīvu kontrolparaugu, ar kura palīdzību pārliecinās, vai šis PCR posms ir izdevies.

Praimeris

Sekvence
1. WSSV 146 F1 ACTACTAACTTCAGCCTATCTAG
2. WSSV 146 R1 TAATGCGGGTGTAATGTTCTTACGA
3. WSSV 146 F2 GTAACTGCCCCTTCCATCTCCA
4. WSSV 146 R2 TACGGCAGCTGCTGCACCTTGT

PCR produktus izgulsnē, izmantojot paņēmienu ar nātrija acetātu, kur 10 μl NaAc, 70 μl H2O un 250 μl etilspirta pievieno 20 μl DNS, apstrādā virpuļmikserī un ar 13 000 rpm 20 minūtes centrifugē, centrifugātu izņem un stobriņu skalo ar 200 μl absolūtā spirta, piecas minūtes centrifugējot ar 13 000 rpm. Stobriņu piecas minūtes žāvē pie 37 oC. Stobriņos pievieno 25 μl Hi-Di formamīda, divas minūtes uzkarsē līdz 95 oC un labi apstrādā virpuļmikserī. Paraugus atbilstoši ražotāja norādījumiem sekvenē ar analizatora ABI3130xl Avant Genetic palīdzību. Sekvenēšanas rezultātus analizē, izmantojot sekvenēšanas programmatūru Sequencher un sekvences ar sekvencēm salāgo, izmantojot BLAST funkciju NCBI datubāzē.

Iekšlietu ministrs Rihards Kozlovskis

Izdruka no oficiālā izdevuma "Latvijas Vēstnesis" (www.vestnesis.lv)

ATSAUKSMĒM

ATSAUKSMĒM

Lūdzu ievadiet atsauksmes tekstu!